ID: 950465480

View in Genome Browser
Species Human (GRCh38)
Location 3:13150908-13150930
Sequence GAAAGCAGATGGTCCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950465475_950465480 22 Left 950465475 3:13150863-13150885 CCTGAGAGTGGTAAATAGAAATT No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data
950465474_950465480 25 Left 950465474 3:13150860-13150882 CCACCTGAGAGTGGTAAATAGAA No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data
950465473_950465480 26 Left 950465473 3:13150859-13150881 CCCACCTGAGAGTGGTAAATAGA No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data
950465472_950465480 27 Left 950465472 3:13150858-13150880 CCCCACCTGAGAGTGGTAAATAG No data
Right 950465480 3:13150908-13150930 GAAAGCAGATGGTCCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950465480 Original CRISPR GAAAGCAGATGGTCCAGGGC TGG Intergenic
No off target data available for this crispr