ID: 950466478

View in Genome Browser
Species Human (GRCh38)
Location 3:13158323-13158345
Sequence GGTATGAAAACTGCTGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950466478_950466482 16 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466482 3:13158362-13158384 AAACTGTGTGTTCTCATTTTGGG No data
950466478_950466483 21 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG No data
950466478_950466484 22 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466484 3:13158368-13158390 TGTGTTCTCATTTTGGGTTTGGG No data
950466478_950466485 23 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466485 3:13158369-13158391 GTGTTCTCATTTTGGGTTTGGGG No data
950466478_950466481 15 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466481 3:13158361-13158383 TAAACTGTGTGTTCTCATTTTGG No data
950466478_950466486 30 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466486 3:13158376-13158398 CATTTTGGGTTTGGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950466478 Original CRISPR GGTATGAAAACTGCTGAACG TGG (reversed) Intergenic
No off target data available for this crispr