ID: 950466479

View in Genome Browser
Species Human (GRCh38)
Location 3:13158344-13158366
Sequence AGTTTATTTTGTTCACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950466479_950466484 1 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466484 3:13158368-13158390 TGTGTTCTCATTTTGGGTTTGGG No data
950466479_950466485 2 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466485 3:13158369-13158391 GTGTTCTCATTTTGGGTTTGGGG No data
950466479_950466487 27 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466487 3:13158394-13158416 AAAGGCCCAGTTAATTACAAAGG No data
950466479_950466481 -6 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466481 3:13158361-13158383 TAAACTGTGTGTTCTCATTTTGG No data
950466479_950466482 -5 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466482 3:13158362-13158384 AAACTGTGTGTTCTCATTTTGGG No data
950466479_950466486 9 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466486 3:13158376-13158398 CATTTTGGGTTTGGGGAAAAAGG No data
950466479_950466483 0 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950466479 Original CRISPR AGTTTATTTTGTTCACAAGG AGG (reversed) Intergenic
No off target data available for this crispr