ID: 950466483

View in Genome Browser
Species Human (GRCh38)
Location 3:13158367-13158389
Sequence GTGTGTTCTCATTTTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950466478_950466483 21 Left 950466478 3:13158323-13158345 CCACGTTCAGCAGTTTTCATACC No data
Right 950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG No data
950466479_950466483 0 Left 950466479 3:13158344-13158366 CCTCCTTGTGAACAAAATAAACT No data
Right 950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG No data
950466480_950466483 -3 Left 950466480 3:13158347-13158369 CCTTGTGAACAAAATAAACTGTG No data
Right 950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950466483 Original CRISPR GTGTGTTCTCATTTTGGGTT TGG Intergenic
No off target data available for this crispr