ID: 950467514

View in Genome Browser
Species Human (GRCh38)
Location 3:13163869-13163891
Sequence CACTCTAAACACAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950467504_950467514 26 Left 950467504 3:13163820-13163842 CCCCAGAAAGGAAGGGACAACCA No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data
950467509_950467514 3 Left 950467509 3:13163843-13163865 CCAACCTAGGTGATCTCTGCAGA No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data
950467503_950467514 30 Left 950467503 3:13163816-13163838 CCAGCCCCAGAAAGGAAGGGACA No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data
950467508_950467514 6 Left 950467508 3:13163840-13163862 CCACCAACCTAGGTGATCTCTGC No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data
950467505_950467514 25 Left 950467505 3:13163821-13163843 CCCAGAAAGGAAGGGACAACCAC No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data
950467511_950467514 -1 Left 950467511 3:13163847-13163869 CCTAGGTGATCTCTGCAGAGGTC No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data
950467506_950467514 24 Left 950467506 3:13163822-13163844 CCAGAAAGGAAGGGACAACCACC No data
Right 950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950467514 Original CRISPR CACTCTAAACACAGGGAAGC TGG Intergenic
No off target data available for this crispr