ID: 950467938

View in Genome Browser
Species Human (GRCh38)
Location 3:13166505-13166527
Sequence GGCCACCTGGAAGCCAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950467938_950467943 23 Left 950467938 3:13166505-13166527 CCCTTACTGGCTTCCAGGTGGCC No data
Right 950467943 3:13166551-13166573 AGCCCCAGTTTCCTCATTTGCGG No data
950467938_950467947 29 Left 950467938 3:13166505-13166527 CCCTTACTGGCTTCCAGGTGGCC No data
Right 950467947 3:13166557-13166579 AGTTTCCTCATTTGCGGATTAGG No data
950467938_950467948 30 Left 950467938 3:13166505-13166527 CCCTTACTGGCTTCCAGGTGGCC No data
Right 950467948 3:13166558-13166580 GTTTCCTCATTTGCGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950467938 Original CRISPR GGCCACCTGGAAGCCAGTAA GGG (reversed) Intergenic
No off target data available for this crispr