ID: 950477547

View in Genome Browser
Species Human (GRCh38)
Location 3:13223512-13223534
Sequence CCTTCTCATCAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950477542_950477547 -7 Left 950477542 3:13223496-13223518 CCTTGGGGATGGCAGCCCTTCTC No data
Right 950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG No data
950477539_950477547 8 Left 950477539 3:13223481-13223503 CCTTGAGGCAGAACTCCTTGGGG No data
Right 950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG No data
950477533_950477547 29 Left 950477533 3:13223460-13223482 CCTCCCTGCTGCAGAGGGAGTCC No data
Right 950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG No data
950477535_950477547 25 Left 950477535 3:13223464-13223486 CCTGCTGCAGAGGGAGTCCTTGA No data
Right 950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG No data
950477534_950477547 26 Left 950477534 3:13223463-13223485 CCCTGCTGCAGAGGGAGTCCTTG No data
Right 950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950477547 Original CRISPR CCTTCTCATCAGAGGGAAGC TGG Intergenic
No off target data available for this crispr