ID: 950477584

View in Genome Browser
Species Human (GRCh38)
Location 3:13223659-13223681
Sequence TGCCCACAAGAGACACACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950477572_950477584 25 Left 950477572 3:13223611-13223633 CCCACCTTCCCCATGCACCCATC No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477579_950477584 7 Left 950477579 3:13223629-13223651 CCATCAGCCAGATCTGAGAACGC No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477575_950477584 17 Left 950477575 3:13223619-13223641 CCCCATGCACCCATCAGCCAGAT No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477573_950477584 24 Left 950477573 3:13223612-13223634 CCACCTTCCCCATGCACCCATCA No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477580_950477584 0 Left 950477580 3:13223636-13223658 CCAGATCTGAGAACGCAAGTTCC No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477578_950477584 8 Left 950477578 3:13223628-13223650 CCCATCAGCCAGATCTGAGAACG No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477576_950477584 16 Left 950477576 3:13223620-13223642 CCCATGCACCCATCAGCCAGATC No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477577_950477584 15 Left 950477577 3:13223621-13223643 CCATGCACCCATCAGCCAGATCT No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data
950477574_950477584 21 Left 950477574 3:13223615-13223637 CCTTCCCCATGCACCCATCAGCC No data
Right 950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950477584 Original CRISPR TGCCCACAAGAGACACACTG GGG Intergenic
No off target data available for this crispr