ID: 950481325

View in Genome Browser
Species Human (GRCh38)
Location 3:13246060-13246082
Sequence CTCTTTCAGAAACTATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950481322_950481325 22 Left 950481322 3:13246015-13246037 CCACTTGAAACGGTGATGTGATG No data
Right 950481325 3:13246060-13246082 CTCTTTCAGAAACTATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950481325 Original CRISPR CTCTTTCAGAAACTATTTGT GGG Intergenic
No off target data available for this crispr