ID: 950481716

View in Genome Browser
Species Human (GRCh38)
Location 3:13248214-13248236
Sequence CTGGAAATCCAGCATCTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950481706_950481716 13 Left 950481706 3:13248178-13248200 CCAAGTGGTCAGACCCCTATTGT No data
Right 950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG No data
950481710_950481716 -2 Left 950481710 3:13248193-13248215 CCTATTGTGTCCCCAAGGCCACT No data
Right 950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG No data
950481709_950481716 -1 Left 950481709 3:13248192-13248214 CCCTATTGTGTCCCCAAGGCCAC No data
Right 950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG No data
950481705_950481716 25 Left 950481705 3:13248166-13248188 CCTGGGCTCTTTCCAAGTGGTCA No data
Right 950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG No data
950481708_950481716 0 Left 950481708 3:13248191-13248213 CCCCTATTGTGTCCCCAAGGCCA No data
Right 950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950481716 Original CRISPR CTGGAAATCCAGCATCTACG TGG Intergenic
No off target data available for this crispr