ID: 950481717

View in Genome Browser
Species Human (GRCh38)
Location 3:13248215-13248237
Sequence TGGAAATCCAGCATCTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950481706_950481717 14 Left 950481706 3:13248178-13248200 CCAAGTGGTCAGACCCCTATTGT No data
Right 950481717 3:13248215-13248237 TGGAAATCCAGCATCTACGTGGG No data
950481709_950481717 0 Left 950481709 3:13248192-13248214 CCCTATTGTGTCCCCAAGGCCAC No data
Right 950481717 3:13248215-13248237 TGGAAATCCAGCATCTACGTGGG No data
950481705_950481717 26 Left 950481705 3:13248166-13248188 CCTGGGCTCTTTCCAAGTGGTCA No data
Right 950481717 3:13248215-13248237 TGGAAATCCAGCATCTACGTGGG No data
950481710_950481717 -1 Left 950481710 3:13248193-13248215 CCTATTGTGTCCCCAAGGCCACT No data
Right 950481717 3:13248215-13248237 TGGAAATCCAGCATCTACGTGGG No data
950481708_950481717 1 Left 950481708 3:13248191-13248213 CCCCTATTGTGTCCCCAAGGCCA No data
Right 950481717 3:13248215-13248237 TGGAAATCCAGCATCTACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950481717 Original CRISPR TGGAAATCCAGCATCTACGT GGG Intergenic
No off target data available for this crispr