ID: 950481721

View in Genome Browser
Species Human (GRCh38)
Location 3:13248231-13248253
Sequence ACGTGGGTTCAGGAGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950481713_950481721 4 Left 950481713 3:13248204-13248226 CCCAAGGCCACTGGAAATCCAGC No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481710_950481721 15 Left 950481710 3:13248193-13248215 CCTATTGTGTCCCCAAGGCCACT No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481715_950481721 -3 Left 950481715 3:13248211-13248233 CCACTGGAAATCCAGCATCTACG No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481708_950481721 17 Left 950481708 3:13248191-13248213 CCCCTATTGTGTCCCCAAGGCCA No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481714_950481721 3 Left 950481714 3:13248205-13248227 CCAAGGCCACTGGAAATCCAGCA No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481709_950481721 16 Left 950481709 3:13248192-13248214 CCCTATTGTGTCCCCAAGGCCAC No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481706_950481721 30 Left 950481706 3:13248178-13248200 CCAAGTGGTCAGACCCCTATTGT No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data
950481712_950481721 5 Left 950481712 3:13248203-13248225 CCCCAAGGCCACTGGAAATCCAG No data
Right 950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950481721 Original CRISPR ACGTGGGTTCAGGAGGAAGC CGG Intergenic
No off target data available for this crispr