ID: 950482345 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:13252208-13252230 |
| Sequence | GATGGACGCCAGGGGCTGAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950482345_950482355 | 30 | Left | 950482345 | 3:13252208-13252230 | CCCCTCAGCCCCTGGCGTCCATC | No data | ||
| Right | 950482355 | 3:13252261-13252283 | ACTCCAGGACACTCTTTATAAGG | No data | ||||
| 950482345_950482354 | 15 | Left | 950482345 | 3:13252208-13252230 | CCCCTCAGCCCCTGGCGTCCATC | No data | ||
| Right | 950482354 | 3:13252246-13252268 | TCTACAAATGTGACTACTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950482345 | Original CRISPR | GATGGACGCCAGGGGCTGAG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||