ID: 950482345

View in Genome Browser
Species Human (GRCh38)
Location 3:13252208-13252230
Sequence GATGGACGCCAGGGGCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482345_950482355 30 Left 950482345 3:13252208-13252230 CCCCTCAGCCCCTGGCGTCCATC No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482345_950482354 15 Left 950482345 3:13252208-13252230 CCCCTCAGCCCCTGGCGTCCATC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482345 Original CRISPR GATGGACGCCAGGGGCTGAG GGG (reversed) Intergenic
No off target data available for this crispr