ID: 950482346

View in Genome Browser
Species Human (GRCh38)
Location 3:13252209-13252231
Sequence GGATGGACGCCAGGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482346_950482354 14 Left 950482346 3:13252209-13252231 CCCTCAGCCCCTGGCGTCCATCC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482346_950482356 30 Left 950482346 3:13252209-13252231 CCCTCAGCCCCTGGCGTCCATCC No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482346_950482355 29 Left 950482346 3:13252209-13252231 CCCTCAGCCCCTGGCGTCCATCC No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482346 Original CRISPR GGATGGACGCCAGGGGCTGA GGG (reversed) Intergenic
No off target data available for this crispr