ID: 950482349

View in Genome Browser
Species Human (GRCh38)
Location 3:13252217-13252239
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482349_950482354 6 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482349_950482357 23 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482357 3:13252263-13252285 TCCAGGACACTCTTTATAAGGGG No data
950482349_950482356 22 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482349_950482355 21 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482349 Original CRISPR AAGTGGAAGGATGGACGCCA GGG (reversed) Intergenic
No off target data available for this crispr