ID: 950482351

View in Genome Browser
Species Human (GRCh38)
Location 3:13252226-13252248
Sequence AGAGACAGAAAGTGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482351_950482356 13 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482351_950482359 23 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482359 3:13252272-13252294 CTCTTTATAAGGGGATCGTATGG No data
950482351_950482354 -3 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482351_950482355 12 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482351_950482357 14 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482357 3:13252263-13252285 TCCAGGACACTCTTTATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482351 Original CRISPR AGAGACAGAAAGTGGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr