ID: 950482353

View in Genome Browser
Species Human (GRCh38)
Location 3:13252234-13252256
Sequence ACATTTGTAGAGACAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482353_950482359 15 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482359 3:13252272-13252294 CTCTTTATAAGGGGATCGTATGG No data
950482353_950482355 4 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482353_950482356 5 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482353_950482357 6 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482357 3:13252263-13252285 TCCAGGACACTCTTTATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482353 Original CRISPR ACATTTGTAGAGACAGAAAG TGG (reversed) Intergenic
No off target data available for this crispr