ID: 950482354

View in Genome Browser
Species Human (GRCh38)
Location 3:13252246-13252268
Sequence TCTACAAATGTGACTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482342_950482354 20 Left 950482342 3:13252203-13252225 CCCCTCCCCTCAGCCCCTGGCGT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482344_950482354 18 Left 950482344 3:13252205-13252227 CCTCCCCTCAGCCCCTGGCGTCC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482345_950482354 15 Left 950482345 3:13252208-13252230 CCCCTCAGCCCCTGGCGTCCATC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482351_950482354 -3 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482347_950482354 13 Left 950482347 3:13252210-13252232 CCTCAGCCCCTGGCGTCCATCCT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482343_950482354 19 Left 950482343 3:13252204-13252226 CCCTCCCCTCAGCCCCTGGCGTC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482339_950482354 26 Left 950482339 3:13252197-13252219 CCAATCCCCCTCCCCTCAGCCCC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482346_950482354 14 Left 950482346 3:13252209-13252231 CCCTCAGCCCCTGGCGTCCATCC No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482349_950482354 6 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482341_950482354 21 Left 950482341 3:13252202-13252224 CCCCCTCCCCTCAGCCCCTGGCG No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482348_950482354 7 Left 950482348 3:13252216-13252238 CCCCTGGCGTCCATCCTTCCACT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482350_950482354 5 Left 950482350 3:13252218-13252240 CCTGGCGTCCATCCTTCCACTTT No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data
950482352_950482354 -7 Left 950482352 3:13252230-13252252 CCTTCCACTTTCTGTCTCTACAA No data
Right 950482354 3:13252246-13252268 TCTACAAATGTGACTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482354 Original CRISPR TCTACAAATGTGACTACTCC AGG Intergenic
No off target data available for this crispr