ID: 950482355

View in Genome Browser
Species Human (GRCh38)
Location 3:13252261-13252283
Sequence ACTCCAGGACACTCTTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482348_950482355 22 Left 950482348 3:13252216-13252238 CCCCTGGCGTCCATCCTTCCACT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482352_950482355 8 Left 950482352 3:13252230-13252252 CCTTCCACTTTCTGTCTCTACAA No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482347_950482355 28 Left 950482347 3:13252210-13252232 CCTCAGCCCCTGGCGTCCATCCT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482349_950482355 21 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482350_950482355 20 Left 950482350 3:13252218-13252240 CCTGGCGTCCATCCTTCCACTTT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482346_950482355 29 Left 950482346 3:13252209-13252231 CCCTCAGCCCCTGGCGTCCATCC No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482351_950482355 12 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482345_950482355 30 Left 950482345 3:13252208-13252230 CCCCTCAGCCCCTGGCGTCCATC No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data
950482353_950482355 4 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482355 3:13252261-13252283 ACTCCAGGACACTCTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482355 Original CRISPR ACTCCAGGACACTCTTTATA AGG Intergenic
No off target data available for this crispr