ID: 950482356

View in Genome Browser
Species Human (GRCh38)
Location 3:13252262-13252284
Sequence CTCCAGGACACTCTTTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482353_950482356 5 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482347_950482356 29 Left 950482347 3:13252210-13252232 CCTCAGCCCCTGGCGTCCATCCT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482351_950482356 13 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482349_950482356 22 Left 950482349 3:13252217-13252239 CCCTGGCGTCCATCCTTCCACTT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482352_950482356 9 Left 950482352 3:13252230-13252252 CCTTCCACTTTCTGTCTCTACAA No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482348_950482356 23 Left 950482348 3:13252216-13252238 CCCCTGGCGTCCATCCTTCCACT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482346_950482356 30 Left 950482346 3:13252209-13252231 CCCTCAGCCCCTGGCGTCCATCC No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data
950482350_950482356 21 Left 950482350 3:13252218-13252240 CCTGGCGTCCATCCTTCCACTTT No data
Right 950482356 3:13252262-13252284 CTCCAGGACACTCTTTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482356 Original CRISPR CTCCAGGACACTCTTTATAA GGG Intergenic
No off target data available for this crispr