ID: 950482359

View in Genome Browser
Species Human (GRCh38)
Location 3:13252272-13252294
Sequence CTCTTTATAAGGGGATCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482353_950482359 15 Left 950482353 3:13252234-13252256 CCACTTTCTGTCTCTACAAATGT No data
Right 950482359 3:13252272-13252294 CTCTTTATAAGGGGATCGTATGG No data
950482352_950482359 19 Left 950482352 3:13252230-13252252 CCTTCCACTTTCTGTCTCTACAA No data
Right 950482359 3:13252272-13252294 CTCTTTATAAGGGGATCGTATGG No data
950482351_950482359 23 Left 950482351 3:13252226-13252248 CCATCCTTCCACTTTCTGTCTCT No data
Right 950482359 3:13252272-13252294 CTCTTTATAAGGGGATCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482359 Original CRISPR CTCTTTATAAGGGGATCGTA TGG Intergenic
No off target data available for this crispr