ID: 950482469

View in Genome Browser
Species Human (GRCh38)
Location 3:13253062-13253084
Sequence AAGCAACCTCACACCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950482469_950482472 -3 Left 950482469 3:13253062-13253084 CCCTGGTGGGTGTGAGGTTGCTT No data
Right 950482472 3:13253082-13253104 CTTCTCGCTGTGGCTTTGACTGG No data
950482469_950482473 22 Left 950482469 3:13253062-13253084 CCCTGGTGGGTGTGAGGTTGCTT No data
Right 950482473 3:13253107-13253129 TTCTCCTGATGATGTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950482469 Original CRISPR AAGCAACCTCACACCCACCA GGG (reversed) Intergenic
No off target data available for this crispr