ID: 950484435

View in Genome Browser
Species Human (GRCh38)
Location 3:13264698-13264720
Sequence TTCAACAAGCGGGAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950484428_950484435 26 Left 950484428 3:13264649-13264671 CCTGGCAGGCTCGCGAAGCAAGT No data
Right 950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950484435 Original CRISPR TTCAACAAGCGGGAGGAGGA CGG Intergenic
No off target data available for this crispr