ID: 950487286

View in Genome Browser
Species Human (GRCh38)
Location 3:13281248-13281270
Sequence AGCTGTGGGTCTCCCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487286_950487294 21 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487294 3:13281292-13281314 GAAGGGAGTCTCAGAGACTCCGG No data
950487286_950487292 3 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487292 3:13281274-13281296 GTGGCAGGACTGAAGAGTGAAGG No data
950487286_950487296 25 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487296 3:13281296-13281318 GGAGTCTCAGAGACTCCGGAGGG No data
950487286_950487295 24 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487295 3:13281295-13281317 GGGAGTCTCAGAGACTCCGGAGG No data
950487286_950487297 30 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data
950487286_950487293 4 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487286 Original CRISPR AGCTGTGGGTCTCCCGGAGC TGG (reversed) Intergenic