ID: 950487287

View in Genome Browser
Species Human (GRCh38)
Location 3:13281254-13281276
Sequence CACAGCAGCTGTGGGTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487287_950487295 18 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487295 3:13281295-13281317 GGGAGTCTCAGAGACTCCGGAGG No data
950487287_950487292 -3 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487292 3:13281274-13281296 GTGGCAGGACTGAAGAGTGAAGG No data
950487287_950487293 -2 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487287_950487296 19 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487296 3:13281296-13281318 GGAGTCTCAGAGACTCCGGAGGG No data
950487287_950487298 29 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487298 3:13281306-13281328 AGACTCCGGAGGGCCAGGAGTGG No data
950487287_950487294 15 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487294 3:13281292-13281314 GAAGGGAGTCTCAGAGACTCCGG No data
950487287_950487297 24 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data
950487287_950487299 30 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487299 3:13281307-13281329 GACTCCGGAGGGCCAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487287 Original CRISPR CACAGCAGCTGTGGGTCTCC CGG (reversed) Intergenic