ID: 950487290

View in Genome Browser
Species Human (GRCh38)
Location 3:13281262-13281284
Sequence AGTCCTGCCACAGCAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487290_950487298 21 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487298 3:13281306-13281328 AGACTCCGGAGGGCCAGGAGTGG No data
950487290_950487296 11 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487296 3:13281296-13281318 GGAGTCTCAGAGACTCCGGAGGG No data
950487290_950487293 -10 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487290_950487299 22 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487299 3:13281307-13281329 GACTCCGGAGGGCCAGGAGTGGG No data
950487290_950487297 16 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data
950487290_950487295 10 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487295 3:13281295-13281317 GGGAGTCTCAGAGACTCCGGAGG No data
950487290_950487294 7 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487294 3:13281292-13281314 GAAGGGAGTCTCAGAGACTCCGG No data
950487290_950487300 23 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487300 3:13281308-13281330 ACTCCGGAGGGCCAGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487290 Original CRISPR AGTCCTGCCACAGCAGCTGT GGG (reversed) Intergenic
No off target data available for this crispr