ID: 950487291

View in Genome Browser
Species Human (GRCh38)
Location 3:13281263-13281285
Sequence CAGTCCTGCCACAGCAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487291_950487300 22 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487300 3:13281308-13281330 ACTCCGGAGGGCCAGGAGTGGGG No data
950487291_950487294 6 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487294 3:13281292-13281314 GAAGGGAGTCTCAGAGACTCCGG No data
950487291_950487296 10 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487296 3:13281296-13281318 GGAGTCTCAGAGACTCCGGAGGG No data
950487291_950487295 9 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487295 3:13281295-13281317 GGGAGTCTCAGAGACTCCGGAGG No data
950487291_950487299 21 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487299 3:13281307-13281329 GACTCCGGAGGGCCAGGAGTGGG No data
950487291_950487298 20 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487298 3:13281306-13281328 AGACTCCGGAGGGCCAGGAGTGG No data
950487291_950487297 15 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487291 Original CRISPR CAGTCCTGCCACAGCAGCTG TGG (reversed) Intergenic
No off target data available for this crispr