ID: 950487293

View in Genome Browser
Species Human (GRCh38)
Location 3:13281275-13281297
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487286_950487293 4 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487283_950487293 15 Left 950487283 3:13281237-13281259 CCCCTGTGAGACCAGCTCCGGGA No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487284_950487293 14 Left 950487284 3:13281238-13281260 CCCTGTGAGACCAGCTCCGGGAG No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487285_950487293 13 Left 950487285 3:13281239-13281261 CCTGTGAGACCAGCTCCGGGAGA No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487290_950487293 -10 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487287_950487293 -2 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487280_950487293 20 Left 950487280 3:13281232-13281254 CCGGGCCCCTGTGAGACCAGCTC No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data
950487279_950487293 21 Left 950487279 3:13281231-13281253 CCCGGGCCCCTGTGAGACCAGCT No data
Right 950487293 3:13281275-13281297 TGGCAGGACTGAAGAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type