ID: 950487297

View in Genome Browser
Species Human (GRCh38)
Location 3:13281301-13281323
Sequence CTCAGAGACTCCGGAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487290_950487297 16 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data
950487287_950487297 24 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data
950487286_950487297 30 Left 950487286 3:13281248-13281270 CCAGCTCCGGGAGACCCACAGCT No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data
950487291_950487297 15 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487297 3:13281301-13281323 CTCAGAGACTCCGGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487297 Original CRISPR CTCAGAGACTCCGGAGGGCC AGG Intergenic
No off target data available for this crispr