ID: 950487298

View in Genome Browser
Species Human (GRCh38)
Location 3:13281306-13281328
Sequence AGACTCCGGAGGGCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487290_950487298 21 Left 950487290 3:13281262-13281284 CCCACAGCTGCTGTGGCAGGACT No data
Right 950487298 3:13281306-13281328 AGACTCCGGAGGGCCAGGAGTGG No data
950487287_950487298 29 Left 950487287 3:13281254-13281276 CCGGGAGACCCACAGCTGCTGTG No data
Right 950487298 3:13281306-13281328 AGACTCCGGAGGGCCAGGAGTGG No data
950487291_950487298 20 Left 950487291 3:13281263-13281285 CCACAGCTGCTGTGGCAGGACTG No data
Right 950487298 3:13281306-13281328 AGACTCCGGAGGGCCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487298 Original CRISPR AGACTCCGGAGGGCCAGGAG TGG Intergenic
No off target data available for this crispr