ID: 950487333

View in Genome Browser
Species Human (GRCh38)
Location 3:13281491-13281513
Sequence GAGGAGGAGCATTGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950487333_950487351 30 Left 950487333 3:13281491-13281513 CCATCCTCACAATGCTCCTCCTC No data
Right 950487351 3:13281544-13281566 CCAGAGCCAGCACACCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950487333 Original CRISPR GAGGAGGAGCATTGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr