ID: 950488277

View in Genome Browser
Species Human (GRCh38)
Location 3:13285582-13285604
Sequence ATGGAGACAGAGAATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950488273_950488277 13 Left 950488273 3:13285546-13285568 CCAGGCTCTGGGCCCATGCTCTT No data
Right 950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG No data
950488270_950488277 30 Left 950488270 3:13285529-13285551 CCGAGCATCGACTGTGGCCAGGC No data
Right 950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG No data
950488275_950488277 0 Left 950488275 3:13285559-13285581 CCATGCTCTTTAAGAGTTCTCAC No data
Right 950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG No data
950488274_950488277 1 Left 950488274 3:13285558-13285580 CCCATGCTCTTTAAGAGTTCTCA No data
Right 950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950488277 Original CRISPR ATGGAGACAGAGAATGAGCA AGG Intergenic
No off target data available for this crispr