ID: 950488733

View in Genome Browser
Species Human (GRCh38)
Location 3:13289383-13289405
Sequence ACTCCAGGTTGAGCCCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950488733_950488743 4 Left 950488733 3:13289383-13289405 CCCGTGAGGGCTCAACCTGGAGT No data
Right 950488743 3:13289410-13289432 CGATGGGGTGCAGTGAGGGTAGG No data
950488733_950488742 0 Left 950488733 3:13289383-13289405 CCCGTGAGGGCTCAACCTGGAGT No data
Right 950488742 3:13289406-13289428 AGGGCGATGGGGTGCAGTGAGGG No data
950488733_950488741 -1 Left 950488733 3:13289383-13289405 CCCGTGAGGGCTCAACCTGGAGT No data
Right 950488741 3:13289405-13289427 TAGGGCGATGGGGTGCAGTGAGG No data
950488733_950488744 11 Left 950488733 3:13289383-13289405 CCCGTGAGGGCTCAACCTGGAGT No data
Right 950488744 3:13289417-13289439 GTGCAGTGAGGGTAGGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950488733 Original CRISPR ACTCCAGGTTGAGCCCTCAC GGG (reversed) Intergenic
No off target data available for this crispr