ID: 950489342

View in Genome Browser
Species Human (GRCh38)
Location 3:13294087-13294109
Sequence TGACGGCGGAGCCTCTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950489342_950489351 23 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489351 3:13294133-13294155 GCCCATGGCTCATATACAGAAGG No data
950489342_950489350 8 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489350 3:13294118-13294140 CCGCACGGCATTTCAGCCCATGG No data
950489342_950489355 29 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489355 3:13294139-13294161 GGCTCATATACAGAAGGTGGAGG No data
950489342_950489356 30 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data
950489342_950489345 -7 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489345 3:13294103-13294125 GCCGTCAGGCCGTTCCCGCACGG No data
950489342_950489354 26 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489354 3:13294136-13294158 CATGGCTCATATACAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950489342 Original CRISPR TGACGGCGGAGCCTCTCTAA AGG (reversed) Intergenic
No off target data available for this crispr