ID: 950489349

View in Genome Browser
Species Human (GRCh38)
Location 3:13294118-13294140
Sequence CCATGGGCTGAAATGCCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950489349_950489351 -8 Left 950489349 3:13294118-13294140 CCGCACGGCATTTCAGCCCATGG No data
Right 950489351 3:13294133-13294155 GCCCATGGCTCATATACAGAAGG No data
950489349_950489355 -2 Left 950489349 3:13294118-13294140 CCGCACGGCATTTCAGCCCATGG No data
Right 950489355 3:13294139-13294161 GGCTCATATACAGAAGGTGGAGG No data
950489349_950489354 -5 Left 950489349 3:13294118-13294140 CCGCACGGCATTTCAGCCCATGG No data
Right 950489354 3:13294136-13294158 CATGGCTCATATACAGAAGGTGG No data
950489349_950489356 -1 Left 950489349 3:13294118-13294140 CCGCACGGCATTTCAGCCCATGG No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950489349 Original CRISPR CCATGGGCTGAAATGCCGTG CGG (reversed) Intergenic
No off target data available for this crispr