ID: 950489356

View in Genome Browser
Species Human (GRCh38)
Location 3:13294140-13294162
Sequence GCTCATATACAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950489346_950489356 13 Left 950489346 3:13294104-13294126 CCGTCAGGCCGTTCCCGCACGGC No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data
950489349_950489356 -1 Left 950489349 3:13294118-13294140 CCGCACGGCATTTCAGCCCATGG No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data
950489344_950489356 16 Left 950489344 3:13294101-13294123 CCGCCGTCAGGCCGTTCCCGCAC No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data
950489348_950489356 0 Left 950489348 3:13294117-13294139 CCCGCACGGCATTTCAGCCCATG No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data
950489342_950489356 30 Left 950489342 3:13294087-13294109 CCTTTAGAGAGGCTCCGCCGTCA No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data
950489347_950489356 5 Left 950489347 3:13294112-13294134 CCGTTCCCGCACGGCATTTCAGC No data
Right 950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950489356 Original CRISPR GCTCATATACAGAAGGTGGA GGG Intergenic
No off target data available for this crispr