ID: 950490273

View in Genome Browser
Species Human (GRCh38)
Location 3:13300473-13300495
Sequence GAGGTTGGGTCTTTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950490273_950490285 26 Left 950490273 3:13300473-13300495 CCACCTCCCAAAGACCCAACCTC No data
Right 950490285 3:13300522-13300544 GTCCAACATGTAAATTTTGGAGG No data
950490273_950490284 23 Left 950490273 3:13300473-13300495 CCACCTCCCAAAGACCCAACCTC No data
Right 950490284 3:13300519-13300541 CAGGTCCAACATGTAAATTTTGG No data
950490273_950490281 4 Left 950490273 3:13300473-13300495 CCACCTCCCAAAGACCCAACCTC No data
Right 950490281 3:13300500-13300522 TACCATTGCCTCAGGCTTTCAGG No data
950490273_950490286 27 Left 950490273 3:13300473-13300495 CCACCTCCCAAAGACCCAACCTC No data
Right 950490286 3:13300523-13300545 TCCAACATGTAAATTTTGGAGGG No data
950490273_950490280 -4 Left 950490273 3:13300473-13300495 CCACCTCCCAAAGACCCAACCTC No data
Right 950490280 3:13300492-13300514 CCTCTTAATACCATTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950490273 Original CRISPR GAGGTTGGGTCTTTGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr