ID: 950494478 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:13325533-13325555 |
Sequence | AGGGTGGATTCCAGCTCCCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 204 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 190} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950494478_950494487 | 18 | Left | 950494478 | 3:13325533-13325555 | CCATGGGAGCTGGAATCCACCCT | 0: 1 1: 0 2: 0 3: 13 4: 190 |
||
Right | 950494487 | 3:13325574-13325596 | ATCACACCCTCTTGAACATGGGG | 0: 1 1: 0 2: 0 3: 8 4: 111 |
||||
950494478_950494486 | 17 | Left | 950494478 | 3:13325533-13325555 | CCATGGGAGCTGGAATCCACCCT | 0: 1 1: 0 2: 0 3: 13 4: 190 |
||
Right | 950494486 | 3:13325573-13325595 | CATCACACCCTCTTGAACATGGG | 0: 1 1: 0 2: 0 3: 14 4: 130 |
||||
950494478_950494485 | 16 | Left | 950494478 | 3:13325533-13325555 | CCATGGGAGCTGGAATCCACCCT | 0: 1 1: 0 2: 0 3: 13 4: 190 |
||
Right | 950494485 | 3:13325572-13325594 | TCATCACACCCTCTTGAACATGG | 0: 1 1: 0 2: 0 3: 6 4: 147 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950494478 | Original CRISPR | AGGGTGGATTCCAGCTCCCA TGG (reversed) | Intronic | ||