ID: 950494478

View in Genome Browser
Species Human (GRCh38)
Location 3:13325533-13325555
Sequence AGGGTGGATTCCAGCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950494478_950494487 18 Left 950494478 3:13325533-13325555 CCATGGGAGCTGGAATCCACCCT 0: 1
1: 0
2: 0
3: 13
4: 190
Right 950494487 3:13325574-13325596 ATCACACCCTCTTGAACATGGGG 0: 1
1: 0
2: 0
3: 8
4: 111
950494478_950494486 17 Left 950494478 3:13325533-13325555 CCATGGGAGCTGGAATCCACCCT 0: 1
1: 0
2: 0
3: 13
4: 190
Right 950494486 3:13325573-13325595 CATCACACCCTCTTGAACATGGG 0: 1
1: 0
2: 0
3: 14
4: 130
950494478_950494485 16 Left 950494478 3:13325533-13325555 CCATGGGAGCTGGAATCCACCCT 0: 1
1: 0
2: 0
3: 13
4: 190
Right 950494485 3:13325572-13325594 TCATCACACCCTCTTGAACATGG 0: 1
1: 0
2: 0
3: 6
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950494478 Original CRISPR AGGGTGGATTCCAGCTCCCA TGG (reversed) Intronic