ID: 950497146

View in Genome Browser
Species Human (GRCh38)
Location 3:13340598-13340620
Sequence GAGCCATCCCCTTAGAGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950497136_950497146 23 Left 950497136 3:13340552-13340574 CCCAAAAGCTGGGCCGTCCCCTT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
950497145_950497146 4 Left 950497145 3:13340571-13340593 CCTTGGAGGGATGGCTTTTATGC 0: 1
1: 0
2: 1
3: 7
4: 120
Right 950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
950497144_950497146 5 Left 950497144 3:13340570-13340592 CCCTTGGAGGGATGGCTTTTATG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
950497143_950497146 6 Left 950497143 3:13340569-13340591 CCCCTTGGAGGGATGGCTTTTAT 0: 1
1: 0
2: 0
3: 8
4: 126
Right 950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
950497137_950497146 22 Left 950497137 3:13340553-13340575 CCAAAAGCTGGGCCGTCCCCTTG 0: 1
1: 0
2: 0
3: 1
4: 97
Right 950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
950497142_950497146 10 Left 950497142 3:13340565-13340587 CCGTCCCCTTGGAGGGATGGCTT 0: 1
1: 0
2: 1
3: 18
4: 150
Right 950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950497146 Original CRISPR GAGCCATCCCCTTAGAGCAG CGG Intronic
900659883 1:3777037-3777059 GAAACATCCCCTTAGGGAAGGGG + Intergenic
903424801 1:23245692-23245714 GAGCCAGCCTCCCAGAGCAGGGG - Intergenic
905367143 1:37458773-37458795 GACTCAACCCCTTAGATCAGGGG + Intergenic
916117764 1:161502228-161502250 CAGCCACCCCCTGGGAGCAGAGG + Intergenic
922187719 1:223290732-223290754 GAGAAATCACCTTAGAGTAGGGG - Intronic
922884375 1:229006834-229006856 GAGCAATCCCCTGAGTGGAGAGG + Intergenic
923789711 1:237101388-237101410 GAGCAATCTCCTTAGCGCAGTGG + Intronic
1071550173 10:86560620-86560642 GAGGCCAACCCTTAGAGCAGAGG - Intergenic
1071721363 10:88149805-88149827 GAGCCATCCCTTTGGAAGAGAGG + Intergenic
1075968844 10:126635952-126635974 GAGCTCTCCCCTCAGCGCAGAGG + Intronic
1077552743 11:3208583-3208605 GGGCCATCCCCTTGGGCCAGAGG - Intergenic
1077605760 11:3610465-3610487 GAGCCATCCCTGCAGAGCAATGG - Intergenic
1080251567 11:30239418-30239440 AAGCCTTTCCCTTAGAGCAGAGG - Intergenic
1081852332 11:46282322-46282344 GAGCCATCCCCCTACTGCACAGG + Intronic
1082119712 11:48365718-48365740 GAGCCTTCCGCTGTGAGCAGAGG + Exonic
1083419282 11:62544311-62544333 GAGCCAACCCCTCGGAGCTGAGG - Intronic
1084411820 11:69010051-69010073 CAGCCATCACCTTAGAGGAAAGG + Intronic
1086172615 11:83852909-83852931 GACTCCTGCCCTTAGAGCAGAGG + Intronic
1090418626 11:126558142-126558164 CAGCCATCCCCTTGGGGCAGAGG - Intronic
1090633232 11:128669121-128669143 AAGACATCCCCTGAGAACAGAGG + Intergenic
1091749348 12:3012719-3012741 GAGCCATCACCTATCAGCAGAGG - Intronic
1095690066 12:45077735-45077757 GATTCATAGCCTTAGAGCAGAGG - Intergenic
1098290085 12:68950009-68950031 GAGCCATCCTCTGAGGCCAGAGG + Intronic
1105557626 13:21461179-21461201 GTGCCATCCCCTTGGATGAGGGG + Intergenic
1106725176 13:32477028-32477050 GAGCCATGCCTTTAGTGAAGAGG + Intronic
1108522799 13:51260304-51260326 GAGCCCTCCCCTGGGAGAAGCGG - Intronic
1108623523 13:52206173-52206195 GACCCATCCCCTTGGGGCTGTGG - Intergenic
1112978452 13:105351243-105351265 TACCCATCCCCTTACATCAGTGG - Intergenic
1113148715 13:107238452-107238474 GAGCCATCCCCAGTCAGCAGAGG - Intronic
1113614524 13:111671144-111671166 GAGCCATCCCCACAGGGCAGGGG + Intronic
1113619992 13:111756058-111756080 GAGCCATCCCCACAGGGCAGGGG + Intergenic
1115267021 14:31511231-31511253 GAGACATACCATTAGAGAAGAGG + Intronic
1115715078 14:36094761-36094783 AAGGCATCCCCTTGGGGCAGAGG + Intergenic
1118363115 14:65072347-65072369 CAGCCAGCCCCCTAGAGCATTGG + Intronic
1120387852 14:83868170-83868192 GATCCATCCCCATAGACCTGAGG + Intergenic
1125454674 15:39844988-39845010 GAGCCAGCTCCTCAGAGCATAGG + Intronic
1126705076 15:51398813-51398835 GAGACCTCCCCTGAGAGAAGGGG + Intronic
1128342163 15:66830189-66830211 GAGGGACCCCCATAGAGCAGGGG - Intergenic
1132949784 16:2554670-2554692 GAGCCTTCCCCGCAGAGCAGAGG - Intronic
1132964564 16:2645497-2645519 GAGCCTTCCCCGCAGAGCAGAGG + Intergenic
1135787340 16:25361829-25361851 GAATCCTCCACTTAGAGCAGAGG + Intergenic
1135865989 16:26102399-26102421 GAGACATTTCCTTACAGCAGTGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136504271 16:30692857-30692879 GTGCCATCTCCTCAGAGCAGAGG + Intergenic
1139253746 16:65521276-65521298 GAGCCCTTCCTTTAGAGTAGAGG + Intergenic
1141804577 16:86334312-86334334 GAGCCAGCCCCTCAGCCCAGAGG - Intergenic
1142221859 16:88859101-88859123 GAGCCACCACCTTTGAGCAGGGG + Intronic
1142222006 16:88860090-88860112 GCACCATCCCCCTAGGGCAGAGG + Intronic
1143712150 17:8742499-8742521 GAGCCCTCCCCTAAGATTAGGGG + Intronic
1149129598 17:53282101-53282123 CAGCCATCCCCACAGAGCAGTGG - Intergenic
1151553426 17:74834936-74834958 GTGCCATCTCCTCAGAGCACTGG + Intronic
1153305268 18:3625090-3625112 GGACCATCTCCTTAGAGAAGTGG - Intronic
1157823397 18:50790325-50790347 GCGCCATCCCCATGAAGCAGAGG + Intergenic
1158402378 18:57132713-57132735 GGGCCAACCCCTTTGAGTAGTGG - Intergenic
1159896880 18:74005631-74005653 CAGCCAAGCCCCTAGAGCAGAGG + Intergenic
1160934260 19:1585647-1585669 GAGCCATCCTCCCAGAGCCGGGG - Intronic
1166723058 19:45008675-45008697 GAGCCACTCCCTGAGAACAGAGG + Intronic
929450870 2:42036184-42036206 GAGCCAGGCCCTCAGAACAGTGG + Intergenic
931923543 2:67046236-67046258 GGGCCTTCCTCTTAGGGCAGTGG - Intergenic
932306643 2:70708302-70708324 GAGCCCTCAGCCTAGAGCAGTGG + Intronic
935953813 2:108354713-108354735 TAGCTCTCCACTTAGAGCAGAGG + Intergenic
937098280 2:119249627-119249649 GGGCCATCCCCTCCGAGCATGGG + Intronic
940225012 2:151392099-151392121 GAAACATCCCCTCAGAGAAGGGG + Intergenic
941325758 2:164111694-164111716 GAGCCAATTCCTTAAAGCAGGGG - Intergenic
944133227 2:196369903-196369925 GAACTCTCCCTTTAGAGCAGTGG + Intronic
946713972 2:222533944-222533966 GAGCCAACCCGTGCGAGCAGTGG + Intronic
946873482 2:224106037-224106059 GAGACATCCCTGTAGAACAGTGG - Intergenic
947664311 2:231893953-231893975 GAGCCTTCACCGTAGAGCAAAGG - Intergenic
1169929204 20:10813817-10813839 GATCCATCCCTATAGAGCAGAGG + Intergenic
1169988817 20:11475446-11475468 TGGCCTTCCCTTTAGAGCAGTGG - Intergenic
1171244709 20:23602105-23602127 GAGCCACCCCTTGAGAACAGAGG + Intergenic
1171332814 20:24356463-24356485 GAGCCACCCCCTCAGACCTGAGG + Intergenic
1175052895 20:56171299-56171321 GAGCCATCTCCTTGGAGCAATGG - Intergenic
1178046331 21:28698039-28698061 GATCCATCTCCTTATAGAAGAGG - Intergenic
1180970416 22:19812072-19812094 GAGCCATCCTCCCAGGGCAGTGG - Intronic
950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG + Intronic
955149430 3:56352431-56352453 GAGACATTCCCTAAGAACAGAGG + Intronic
955346379 3:58164931-58164953 GAGCCAGCCACTTAGAGAGGGGG - Intronic
960690491 3:120341903-120341925 CAGCCCTCCCCCTAGAGCACAGG - Intronic
963306097 3:143654827-143654849 GAGTCTTCCCCATAGGGCAGAGG - Intronic
968074272 3:195807995-195808017 GGGCCATGGCCCTAGAGCAGGGG - Intronic
972520293 4:39848170-39848192 TAATGATCCCCTTAGAGCAGTGG - Intronic
973981081 4:56308811-56308833 CAGCCATCGCCTTGGTGCAGGGG + Intronic
974154395 4:58052208-58052230 GAATCATGCGCTTAGAGCAGAGG - Intergenic
978249117 4:106609958-106609980 CAACCAGCCCCTTAGGGCAGTGG - Intergenic
980035839 4:127881468-127881490 CCGCCATCCCCTTGGAGAAGTGG - Intronic
982444911 4:155479064-155479086 GAGAAATCCCCTGAGAGTAGTGG + Intergenic
986443616 5:7802037-7802059 AAGCTTTCCCCTGAGAGCAGCGG + Intronic
986527540 5:8696594-8696616 CAGCCATCCCCTTTGAGGAAAGG + Intergenic
990579071 5:57150936-57150958 GATCCATCCCTTCAGGGCAGTGG + Intergenic
992979755 5:82156542-82156564 GGGCCTTCCTCCTAGAGCAGAGG + Intronic
999720395 5:154395031-154395053 GAGCCGTCTCCTTGGAGGAGTGG - Intronic
1000114499 5:158140434-158140456 GAGCAATGCCATTAGAGGAGAGG - Intergenic
1001058539 5:168468919-168468941 AGGCCATCCCTTTAGAGCAGGGG - Intronic
1001287165 5:170432056-170432078 GAGCCATCTTCTTACAGCTGAGG + Intronic
1002453772 5:179334004-179334026 GTGCCACCACCTCAGAGCAGCGG + Intronic
1004127017 6:12883642-12883664 GAGCCATCCCCAGACAGCACAGG - Intronic
1006370354 6:33640408-33640430 TATCCCTTCCCTTAGAGCAGGGG - Intronic
1006515061 6:34541190-34541212 GAGGCATCCCCTCAGCTCAGGGG + Intronic
1007389081 6:41539567-41539589 GAGCCATCCCCTTCTCTCAGAGG - Intergenic
1010128608 6:72464956-72464978 GAGCCATTCCTATAAAGCAGAGG - Intergenic
1014255503 6:119157079-119157101 GAGCCAGCCCCTTGGGGCTGAGG + Intergenic
1014575959 6:123073254-123073276 AAGTCTTCCCCTTAAAGCAGTGG + Intergenic
1020108729 7:5435728-5435750 GAGCCAGCTCCTGTGAGCAGAGG - Intronic
1020408467 7:7864727-7864749 GAGCCATCTCATTAGTACAGTGG - Intronic
1025072843 7:55916148-55916170 GAGCCATGCGCTTTGAGCAGAGG - Intronic
1026310087 7:69175789-69175811 AAGCAAGCCCATTAGAGCAGGGG + Intergenic
1029954057 7:104618901-104618923 GATCCATTCCATTAGTGCAGAGG - Intronic
1031035676 7:116785314-116785336 GAGACCTCCCCTTAGTGCTGGGG - Intronic
1034890492 7:154835041-154835063 CTGACATCACCTTAGAGCAGTGG + Intronic
1035045348 7:155962067-155962089 AAGCCAGCCGCTTGGAGCAGAGG + Intergenic
1048614907 8:136063198-136063220 GAGCAATTCCCTTTGAGAAGTGG + Intergenic
1049465590 8:142749926-142749948 GGGCCATCTCCTTGGAGGAGGGG - Intergenic
1049590898 8:143461915-143461937 GAACCATACACCTAGAGCAGAGG + Intronic
1049671397 8:143871682-143871704 AGGCCATCTCCTCAGAGCAGAGG - Exonic
1049928710 9:434988-435010 CAGCTTTTCCCTTAGAGCAGTGG + Intronic
1052038031 9:23705546-23705568 GGGCCAATCCCCTAGAGCAGTGG + Intronic
1053387662 9:37707539-37707561 GAGCCTTCCCCTTACAGTGGTGG + Exonic
1057380016 9:94559185-94559207 GAGCCATGCCCCTAAAGCTGGGG + Intronic
1189478373 X:41374701-41374723 GAGCCATACCCCTAGAACTGGGG - Intergenic
1190950123 X:55135374-55135396 GAGCCATCCACTTTCAGGAGTGG + Intronic
1195009586 X:100722428-100722450 AGGCCAACCTCTTAGAGCAGGGG - Intronic
1196378041 X:115056579-115056601 GAGCAAGTCCCTTAGAGAAGAGG - Intergenic
1197789648 X:130241431-130241453 GAAGCATTGCCTTAGAGCAGTGG - Intronic
1198574417 X:137994297-137994319 GAGCGCTTCCATTAGAGCAGGGG + Intergenic