ID: 950498400

View in Genome Browser
Species Human (GRCh38)
Location 3:13348199-13348221
Sequence CATGGGAGTCAAGTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950498400 Original CRISPR CATGGGAGTCAAGTTTCCCC AGG (reversed) Intronic
900511143 1:3061779-3061801 CCTGGGAGTCCAATTTCCCAAGG - Intergenic
900709587 1:4105216-4105238 CATGGGAGTCAGGCTGCCCGAGG - Intergenic
904289345 1:29474075-29474097 CATGAGAGTCCAGATTCCCCTGG - Intergenic
905911302 1:41656818-41656840 CATCAGAGTCAAGTTCCTCCTGG + Intronic
908856747 1:68438650-68438672 GATGGGGCTCAAGTTTCCCCAGG + Intronic
911505087 1:98739049-98739071 CATGGAAGACAAGTTTTCCTAGG + Intronic
912212126 1:107567877-107567899 GCTTGGAGTCAAGTTTCCCTTGG - Intergenic
913974376 1:143442869-143442891 AATGGGAGACATGTATCCCCTGG + Intergenic
916755840 1:167769568-167769590 CATGGGAGTGAAGATTTCACAGG + Intronic
917031866 1:170701976-170701998 CATGGAAGTCAATTTTTCCATGG + Intronic
917599327 1:176558953-176558975 GACAGGGGTCAAGTTTCCCCAGG - Intronic
917942302 1:179934638-179934660 GATAGGAGTCATGTTGCCCCAGG + Intergenic
918342084 1:183576300-183576322 CATGGGAGGAATGTTTCCCCTGG - Intronic
921071758 1:211665318-211665340 CATAGGAATCAAGTATCCACTGG - Intronic
923859405 1:237877859-237877881 CATGGGAGTAGAGTTTCCAAAGG + Exonic
1064535100 10:16350158-16350180 AATGGGAGCCAAGTTTCTCATGG + Intergenic
1064720170 10:18220875-18220897 CATGGAAGATAAGTTTCCCACGG - Intronic
1068762905 10:60733066-60733088 CGTGGGAGTCCAGTTGCGCCTGG - Intronic
1069723154 10:70562173-70562195 CATGGGACTCATGTCTCCCAGGG + Intronic
1072850800 10:98889655-98889677 CAAGGGAGTCAAGTGGGCCCTGG + Intronic
1073007563 10:100336446-100336468 TATGGAAGGCAACTTTCCCCAGG - Intergenic
1073538049 10:104295641-104295663 CAGGGGAGGTAAGTTGCCCCAGG + Intronic
1074121971 10:110499416-110499438 CATGTGGGTCAGGTCTCCCCGGG - Intronic
1074968577 10:118516275-118516297 CATGGGAGACAATTTTTCCATGG + Intergenic
1075617256 10:123899712-123899734 TATGAGAGCCAAGTTTCCCAAGG - Intronic
1075846656 10:125550520-125550542 CTTGAGAGTCGACTTTCCCCAGG - Intergenic
1077125561 11:934077-934099 CATGGGAGTCAGGACTTCCCTGG - Intronic
1078541923 11:12219883-12219905 CAGGGGAGGCAATTTTTCCCTGG - Intronic
1079305040 11:19314520-19314542 CAGGTGAGTCAAGGCTCCCCAGG - Intergenic
1079538243 11:21540729-21540751 CATGGGAGTAGATGTTCCCCTGG - Intronic
1080831976 11:35903372-35903394 CATGGGAGACAACTTTTCCACGG + Intergenic
1081294224 11:41365476-41365498 CATGGAAGACAAGTTTTCCATGG - Intronic
1082740794 11:56908809-56908831 CATGGAAGACAATTTTCCCATGG + Intergenic
1083148546 11:60775850-60775872 CATCTGAGTGAAGTGTCCCCAGG + Exonic
1084292657 11:68184591-68184613 CCTGGGTATCAAGTTCCCCCAGG + Intronic
1088361947 11:109000798-109000820 TCAGGGTGTCAAGTTTCCCCAGG + Intergenic
1089850331 11:121490360-121490382 CAAGGGCCTCAAGATTCCCCTGG - Intronic
1090845873 11:130529260-130529282 CAAGGTAGCCAAGTTTACCCTGG - Intergenic
1094477373 12:30851654-30851676 CATGTGAGTCACGTGTCCACCGG - Intergenic
1096585568 12:52617590-52617612 CATGGCAGTCTAGATGCCCCAGG + Intronic
1098814717 12:75143984-75144006 CATGGGAGTGAAGATTACCTAGG + Intronic
1099155273 12:79167792-79167814 CATGGAAGACAATTTTTCCCTGG + Intronic
1101649373 12:106660934-106660956 CATGGAAGACAATTTTCCCTTGG - Intronic
1103233961 12:119356285-119356307 TATGGAAATCAAGTTTCCCTAGG + Intronic
1103699568 12:122841868-122841890 CATGAGAGCCCAGGTTCCCCAGG - Intronic
1105690431 13:22832065-22832087 CATGGGAGAAATGTGTCCCCTGG - Intergenic
1107178187 13:37423660-37423682 TCAGGGAGACAAGTTTCCCCTGG - Intergenic
1107683760 13:42876478-42876500 CATAGGATCAAAGTTTCCCCAGG + Intergenic
1107779145 13:43879666-43879688 CCTGGCCGTCAGGTTTCCCCTGG + Exonic
1108961547 13:56238514-56238536 CCTGAAAGTCAAGTTTCACCAGG + Intergenic
1109955267 13:69557498-69557520 CATAGTAGTCCAGTTTCCCTTGG - Intergenic
1110795632 13:79634172-79634194 AATGAGAGTCAGGTTTCCCATGG + Intergenic
1111665904 13:91267445-91267467 CATGGGACTCCAATTTCCTCAGG + Intergenic
1112183392 13:97106468-97106490 CATGGGGGTCCAGCTACCCCAGG - Intergenic
1113584294 13:111452797-111452819 CATGATAGTTAAGTTTCCCGAGG + Intergenic
1114237722 14:20836810-20836832 TTTGGGAGTTAAGTATCCCCAGG - Intergenic
1115154875 14:30327172-30327194 CATGGAAGTGATGTTTCCCTGGG + Intergenic
1115766373 14:36627266-36627288 AATGGGACTCAACTTTCCCTAGG - Intergenic
1118699213 14:68416754-68416776 GATGGGAGTCAGGCTTCCCCTGG + Intronic
1121117177 14:91352015-91352037 CTTGAGACTCAAGTTTGCCCTGG + Intronic
1121713216 14:96054247-96054269 CATGGGAGTCAGGTCTCCCTGGG + Intronic
1123113206 14:105882493-105882515 CATGGGAATCCAGAATCCCCAGG - Intergenic
1123115556 14:105892644-105892666 CATGGGAATCCGGTATCCCCAGG - Intergenic
1123119802 14:105911361-105911383 CATGGGAATCCAGAATCCCCAGG - Intergenic
1125855020 15:42940190-42940212 CATTGGAGGCAAGTATCACCGGG - Intergenic
1127217209 15:56835945-56835967 CATGGGACTCTACTTTCCCTAGG + Intronic
1127568183 15:60214079-60214101 CATGGAAGACAATTTTCCCATGG + Intergenic
1128796941 15:70472930-70472952 CCTGGGCCTCAAGTTTCCACAGG + Intergenic
1129988916 15:79944680-79944702 CATTGGAGGCAAGTATCACCGGG + Intergenic
1130712789 15:86300281-86300303 AATGGGACTCAACTTTCTCCAGG - Intronic
1132033306 15:98457102-98457124 CATGGAAGACAATTTTCCCATGG + Intronic
1133535785 16:6701207-6701229 CATTGGATGCAAGTTGCCCCAGG + Intronic
1134222766 16:12368155-12368177 CATGGGTGGTCAGTTTCCCCTGG + Intronic
1136268514 16:29134379-29134401 CCTGGGGGTCAAGTGTTCCCTGG + Intergenic
1140280045 16:73545580-73545602 AATCGGAGCCCAGTTTCCCCAGG + Intergenic
1140590540 16:76346763-76346785 TATGACAGCCAAGTTTCCCCTGG - Intronic
1142071825 16:88094716-88094738 CCTGGGGGTCAAGTGTTCCCTGG + Intronic
1142813424 17:2407332-2407354 CATGGGAGTCAAGAGTCCGCTGG + Intronic
1146517885 17:33503454-33503476 CCTGGGAGTCAGGGTTCCCCAGG + Intronic
1146822059 17:35991488-35991510 CCTGGGACTCAAGTATCCCCAGG - Intronic
1150368509 17:64613647-64613669 CATGGAAGACAAGTTTTCCACGG + Intronic
1154065196 18:11101073-11101095 CATGGGACTCATCTGTCCCCTGG - Intronic
1158129863 18:54140412-54140434 CATAGGGGTGAATTTTCCCCTGG + Intergenic
1158387631 18:57013062-57013084 CATGGAAGACAAGTTTTCCATGG + Intronic
1158496564 18:57960329-57960351 CATGAGAGTGAAGATTACCCAGG + Intergenic
1160527313 18:79545324-79545346 CAGGGGTGTCTTGTTTCCCCGGG - Intergenic
1162526852 19:11211206-11211228 CAGGTGACTCAAGTTTCCACAGG - Intronic
1163892599 19:20030104-20030126 CTGGGGAGTCAAGTTTCTCTTGG - Intronic
1165977811 19:39692562-39692584 CATAGGAGTGATGTTTCCTCAGG + Intergenic
1166673276 19:44724183-44724205 CCTGGGAGTCAAATGGCCCCAGG - Intergenic
1167200724 19:48063428-48063450 AATGGGAGGCAGGTTTGCCCTGG + Intronic
1167206796 19:48107932-48107954 CATGTGAGTCACGTGTCCACTGG - Intronic
1167766450 19:51485925-51485947 CATGGGAGGCAACTTTGCCCTGG + Intronic
1168510527 19:56969990-56970012 CATGAGAGGGAAGTTTCTCCCGG - Intergenic
925126580 2:1461458-1461480 GGTGGAAGTCCAGTTTCCCCAGG - Intronic
927339532 2:21966623-21966645 CATGGAAGACAAGTTTTCCATGG + Intergenic
928730564 2:34227016-34227038 CACTGGAGTCAGTTTTCCCCAGG - Intergenic
929069939 2:38020098-38020120 CATGGAAGACAATTTTTCCCTGG + Intronic
932748385 2:74354469-74354491 CATGGAAGACAATTTTCCCATGG + Intronic
933380641 2:81539416-81539438 CATGGAAGACAATTTTCCCAGGG + Intergenic
934179081 2:89603844-89603866 AATGGGAGACATGTATCCCCTGG + Intergenic
934289366 2:91678114-91678136 AATGGGAGACATGTATCCCCTGG + Intergenic
934950294 2:98571281-98571303 CATGGAGGGCAAGTCTCCCCAGG + Intronic
939938069 2:148316132-148316154 CATGGGGGTAGATTTTCCCCTGG - Intronic
940810550 2:158237913-158237935 CAAGGGAATCAAGTTTTCCAAGG + Intronic
944655452 2:201872687-201872709 CATGGGGGTCATGCTTTCCCAGG + Intronic
945051329 2:205826971-205826993 CGTGGAAGTCTTGTTTCCCCAGG - Intergenic
946541581 2:220689916-220689938 CATGGAAGACAAATTTTCCCTGG + Intergenic
946750052 2:222885210-222885232 CATGGCACATAAGTTTCCCCAGG + Intronic
948710598 2:239822641-239822663 CATGGGGGTGGAGTTCCCCCTGG + Intergenic
1170190757 20:13642517-13642539 CATGGGAGTCAAGTAATCTCTGG - Intergenic
1171171270 20:23017497-23017519 CATGGGAGTCCAGCTGACCCAGG - Intergenic
1173570624 20:44073437-44073459 CATGGAAGACAACTTTCCCATGG - Intergenic
1173951511 20:46997280-46997302 CATGGGGGTGTATTTTCCCCTGG - Intronic
1174305635 20:49612459-49612481 CAGGAGACTCAAGTTTCCCTGGG + Intergenic
1182795104 22:32986190-32986212 GATGGCAGTCAAGTGTCTCCAGG - Intronic
1185341698 22:50293899-50293921 CCTGGGAGTCAGGCTTTCCCTGG - Intronic
1185355626 22:50367973-50367995 CATGCGAGTCACGTGTCCACTGG + Intronic
950071582 3:10157034-10157056 CATGGGAGGTAATTTTCCCCAGG - Intergenic
950498400 3:13348199-13348221 CATGGGAGTCAAGTTTCCCCAGG - Intronic
951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG + Intergenic
952058401 3:29477321-29477343 TATGGGAGTCAAGTATGTCCAGG - Intronic
952486057 3:33811208-33811230 AATGGAAGCCAAGTTTCCCAAGG - Intronic
953678581 3:45022405-45022427 CATGGAAGACAATTTTCCCACGG + Intronic
958643527 3:96839446-96839468 CATGGAAGACAATTTTCCCATGG - Intronic
959022981 3:101209042-101209064 AATGGTAGCCAAGTTTCCCTGGG - Intergenic
960604397 3:119489966-119489988 CATGGGAGACAATTTTTCCATGG - Intronic
966122371 3:176536829-176536851 CATGGCTGTCAAGTTGCCCAAGG - Intergenic
968559104 4:1267683-1267705 CATGTGAGTCATGTGTCCACTGG + Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969630563 4:8333399-8333421 CAGGGGAGTTTCGTTTCCCCGGG - Intergenic
969845578 4:9917733-9917755 CATGGGAGCAAAATTGCCCCTGG - Intronic
972110752 4:35555965-35555987 CATGAGAGTGAAGTTTCCAAAGG - Intergenic
975477941 4:74844352-74844374 CATGGAAGACAATTTTCCCACGG - Intergenic
976111076 4:81674526-81674548 CATGGAAGACAATTTTTCCCTGG + Intronic
977071680 4:92397921-92397943 CAAGTGATTCTAGTTTCCCCAGG - Intronic
978756658 4:112309850-112309872 CATGTAAGTCAAGTCTTCCCAGG - Intronic
981019701 4:140012680-140012702 CCAGCCAGTCAAGTTTCCCCAGG + Intronic
988589540 5:32536825-32536847 CATGGGAGACAATTTTTCCATGG - Intronic
988906880 5:35799308-35799330 CCTGGGAGTCAAATATCCTCTGG - Intronic
992625193 5:78630519-78630541 CATGGTCTTCAAGTTTCCCAGGG - Intronic
992940415 5:81755551-81755573 CCTGGGAGTGAAGTTTCACAAGG - Intergenic
994619916 5:102150771-102150793 AATGGGAGGCAGGTTTGCCCAGG - Intergenic
994819779 5:104634505-104634527 CATGGAAGTCAATTTTTCCATGG + Intergenic
995869561 5:116730028-116730050 CATCGGAATCAATTTTCCCTTGG - Intergenic
997885972 5:137630261-137630283 CCTGGGAGTCCAGTGTCCCTGGG - Intronic
997931745 5:138078170-138078192 ACTGGGAGTCAAGTATCCTCAGG + Intergenic
998453964 5:142256113-142256135 CATGGCAGTCAGCTTCCCCCAGG - Intergenic
1000245840 5:159447761-159447783 CATGAGAGTGAAGTTTCTCTTGG + Intergenic
1005361132 6:25032061-25032083 AATAGGAGTAAAGTTTCCCTTGG + Intronic
1008312236 6:49990276-49990298 TCAGGGTGTCAAGTTTCCCCAGG - Intergenic
1009443085 6:63705602-63705624 CATGGAAGACAATTTTCCCATGG - Intronic
1016608344 6:145960838-145960860 CATGGAAGACAAGTTTTCCATGG + Intronic
1016702266 6:147067227-147067249 CATGGAAGACAATTTTCCCACGG + Intergenic
1022511422 7:30937118-30937140 CCTGGGAGGCACCTTTCCCCAGG + Intergenic
1027492003 7:78839696-78839718 CATGGGAGGCAATTTCCCCCAGG - Intronic
1027930879 7:84533510-84533532 CATGGGAGTGAGATTTTCCCTGG + Intergenic
1029128890 7:98314849-98314871 CCTGCGAGTCAGCTTTCCCCAGG - Intronic
1032535566 7:132660276-132660298 TATGGGAGACAGGTTTGCCCGGG + Intronic
1032673647 7:134108321-134108343 CATGGGAGAGAAGTTTCCTCTGG + Intergenic
1035347642 7:158214806-158214828 GATGGAAGTCTAGATTCCCCAGG - Intronic
1035438369 7:158876282-158876304 CATGGGGGTGAATTTCCCCCTGG - Intronic
1037140915 8:15519685-15519707 CATGGAAGACAATTTTCCCACGG - Intronic
1037759899 8:21734894-21734916 AATGGGAGGCAGGTTTGCCCTGG - Intronic
1039070689 8:33647015-33647037 CATGGGAGACAATTTTTCCATGG + Intergenic
1045447834 8:102285966-102285988 CGTGGGGGTCAGATTTCCCCTGG - Intronic
1046524554 8:115367788-115367810 CATGGAAGACAAGTTTTCCACGG - Intergenic
1050061079 9:1710462-1710484 CATGGGAGTCATGTATCACCTGG - Intergenic
1051358260 9:16259637-16259659 CATGTCACCCAAGTTTCCCCGGG + Intronic
1051450390 9:17191451-17191473 AATGTGTGTCAAGTTTCCCAGGG - Intronic
1052860647 9:33435875-33435897 CAGTGGAGTCAGCTTTCCCCAGG - Intergenic
1055057868 9:72040104-72040126 CATGGAAGACAATTTTCCCACGG + Intergenic
1057177050 9:93007976-93007998 CATGACAGTCAAGTTGCCCATGG + Intronic
1057845802 9:98521505-98521527 TATTGAAGTCCAGTTTCCCCAGG + Intronic
1061682943 9:132252326-132252348 CATGTGAGTCACGTGTCCACCGG + Intergenic
1062248458 9:135582390-135582412 CATGGAAGACAATTTTCCCATGG + Intergenic
1062557577 9:137121744-137121766 AAAGGGAGTCTCGTTTCCCCAGG + Intergenic
1062557628 9:137122067-137122089 CATGTGAGTCACGTGTCCACCGG - Intergenic
1186053378 X:5623993-5624015 CATGGGGGTGAAGCTTCCCAAGG + Intergenic
1186918136 X:14245900-14245922 CTTGGGGGTTATGTTTCCCCAGG - Intergenic
1187568210 X:20474122-20474144 CATGGGTTCCAAGTTTCCCTGGG - Intergenic
1189595633 X:42562570-42562592 TATGGGATTCAAGTTACTCCAGG + Intergenic
1189776834 X:44477242-44477264 CATTGGAGGCAAGTATCACCAGG - Intergenic
1194807520 X:98347790-98347812 CATTGGAGTGGAGTTTTCCCAGG + Intergenic
1196608689 X:117685892-117685914 CATGGAAGACAATTTTCCCATGG - Intergenic