ID: 950499749

View in Genome Browser
Species Human (GRCh38)
Location 3:13356085-13356107
Sequence GACTGATTAGGGGCTTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950499749_950499761 24 Left 950499749 3:13356085-13356107 CCCATTCAAGCCCCTAATCAGTC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 950499761 3:13356132-13356154 GTGAGTGAGCCACACGCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950499749 Original CRISPR GACTGATTAGGGGCTTGAAT GGG (reversed) Intronic
905252104 1:36656108-36656130 GACTGAGTAGGGGGTAGGATAGG - Intergenic
907552590 1:55316827-55316849 GGCTGAGTTGGGGCTTGGATGGG + Intergenic
908660328 1:66427899-66427921 TACTGATGAGGGGCTTGTATAGG - Intergenic
911123603 1:94319871-94319893 GAATGAGTATGGGCATGAATAGG - Intergenic
911252827 1:95597560-95597582 AACTTATAAGGGGCTTGACTGGG + Intergenic
911272217 1:95816023-95816045 GATTTATTAGTGACTTGAATGGG - Intergenic
913195885 1:116455486-116455508 GAATGGTTAGGGGCTTGAAAAGG - Intergenic
921375881 1:214472792-214472814 GACAGATCAGGGGCTAGAAAAGG - Intronic
922354649 1:224764373-224764395 GCCTGACTGGGGGCTTGACTGGG - Intergenic
924371008 1:243349710-243349732 GACTTACTAGTGGCTTGGATGGG + Intronic
1065626222 10:27631606-27631628 GAGTGATTAGGAGCTTGAGGGGG + Intergenic
1071114767 10:82205156-82205178 AACTGATGATGGGGTTGAATTGG - Intronic
1081908006 11:46681291-46681313 ACCTGATGAGGGGCTTGAAGAGG + Exonic
1083115569 11:60456112-60456134 GACTGATTAGAGGAGTGAGTGGG - Intronic
1085043555 11:73340814-73340836 GACTGAGTGGTGGCTTGAAAGGG - Intronic
1089010236 11:115126313-115126335 GACTGATGAGGGGCGGGCATGGG + Intergenic
1094226403 12:28051011-28051033 GACTGATTTGGGGCAATAATTGG - Intergenic
1096563603 12:52456140-52456162 GACTGATTAGGGGATTTCAGTGG + Intergenic
1103295997 12:119887694-119887716 GACTGTTGATGGGTTTGAATCGG + Intergenic
1104145067 12:126025188-126025210 GGCTGATTAGGGGCATGAGAGGG - Intergenic
1106897406 13:34319094-34319116 GACTGACTTGGGGCTTCAAAAGG - Intergenic
1106941156 13:34780617-34780639 TACTGATTAGGGTCTAGACTCGG + Intergenic
1110461973 13:75755103-75755125 GACTGATAGGAGGCTTGAGTAGG + Intronic
1122940134 14:104977522-104977544 GCCTGGTGAGGGGCCTGAATGGG - Intronic
1128159620 15:65415158-65415180 TACTGCTTAGTGGCTGGAATGGG - Intronic
1132616811 16:845165-845187 GACGTGTTGGGGGCTTGAATCGG + Intergenic
1133342970 16:5049808-5049830 TACTAATTTGGGGCTTGATTTGG - Intronic
1135552504 16:23408837-23408859 GACTGGTTAGGAGCACGAATGGG + Intronic
1144141079 17:12348616-12348638 GACCTATTATGGGCTTGAAATGG + Intergenic
1144419483 17:15083272-15083294 GACTTATTTGAGGCTTGGATTGG - Intergenic
1146270103 17:31479426-31479448 GAATGGTTAGGGCCCTGAATGGG - Intronic
1146507411 17:33417262-33417284 TAAGGATTAGGGGCTTGAACTGG - Intronic
1151000253 17:70367861-70367883 GACTGCTTAAGGGCTACAATTGG + Intergenic
1153690838 18:7592149-7592171 GACTGCTTATGGGTTTGACTTGG - Intronic
1160170486 18:76548876-76548898 GACTGATTTGGGATTTGATTTGG + Intergenic
1160886426 19:1351141-1351163 GCCTAATTAGGGACTTGAATGGG + Intergenic
1164346228 19:27262736-27262758 GGCTGATTAGGGGCCTTCATTGG + Intergenic
1167462480 19:49633096-49633118 GACAGAATAGGGGGTTGGATGGG + Intergenic
928022726 2:27716324-27716346 GCCTGGTCAGGGGCTGGAATGGG - Intergenic
928994555 2:37273332-37273354 TACTGATTTGGGGTTGGAATGGG - Intronic
931019054 2:58021956-58021978 GACTGATTAAGGGTTTCAAGTGG - Intronic
941546910 2:166862128-166862150 GACAGAATAGGAGATTGAATAGG - Intergenic
942849924 2:180472527-180472549 GACTGAAAAGTGGCTTTAATAGG - Intergenic
943346355 2:186742390-186742412 GACTGATTAATGGATTAAATTGG - Intronic
1171100782 20:22381921-22381943 GGCTGGATAGGGGCCTGAATAGG - Intergenic
1174860714 20:54088577-54088599 GCCTGGCTACGGGCTTGAATTGG - Intergenic
1174983127 20:55419889-55419911 ACCTGATTAGAGGCATGAATGGG - Intergenic
1179162725 21:38911240-38911262 CACTCATTAGGGGCGTGACTGGG - Intergenic
1180863993 22:19105447-19105469 GAATAATAAGGGCCTTGAATGGG + Intronic
949463580 3:4320538-4320560 AAATGAATAGGGGCTTGAAGGGG + Intronic
950499749 3:13356085-13356107 GACTGATTAGGGGCTTGAATGGG - Intronic
952744066 3:36761716-36761738 TACTGGGTAGGGGCTTGGATGGG - Intergenic
955025475 3:55163508-55163530 GAATGAGTAGGGACTTGAAAAGG + Intergenic
956772903 3:72541628-72541650 GTCTCATTAGAGGCTTGACTGGG + Intergenic
963872025 3:150427323-150427345 GACTGATGGGGGGCATGAAGAGG - Intronic
963941659 3:151101857-151101879 GACTGATCAGGGCTTTAAATAGG + Intronic
974808702 4:66917231-66917253 GACAGATTTGGGGGTTGAAGTGG - Intergenic
979817938 4:125133482-125133504 GATTGGTTAGGGACTTGAAATGG + Intergenic
984218254 4:176941477-176941499 GCCTGATTTGGCCCTTGAATTGG + Intergenic
984441620 4:179778125-179778147 GCATGAATAGGAGCTTGAATAGG + Intergenic
984777138 4:183491555-183491577 GACTGAGGAGGGGGTGGAATAGG - Intergenic
988101019 5:26678755-26678777 GACTTATGAGAGGTTTGAATAGG + Intergenic
989451691 5:41594038-41594060 GGCTGTTTAGGGTCTTTAATTGG - Intergenic
993086608 5:83370727-83370749 GATGGATTGGGGGCTGGAATTGG - Intergenic
1004737305 6:18420406-18420428 GATTGATTAGGTGCTTGTAGGGG + Intronic
1006360360 6:33584066-33584088 GACAGGTGAGGGGCTGGAATTGG + Intergenic
1010889937 6:81294122-81294144 GACAGATTAGGGCTTTGAAGAGG - Intergenic
1015578771 6:134701472-134701494 TACTCATTAGGGGCCTGAAGTGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1022966994 7:35483151-35483173 TACTGATGAGGGGCTTGCAGGGG - Intergenic
1023112683 7:36829959-36829981 GGGTGATTAGGGGCTGGAAAAGG + Intergenic
1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG + Intronic
1026294433 7:69038859-69038881 GAATCATTAGGGGCCTGAAAGGG + Intergenic
1032441868 7:131948271-131948293 GACTGATTATGGGCTACAATGGG - Intergenic
1033864487 7:145672255-145672277 GACTGCTCAGGGGCCAGAATAGG + Intergenic
1035716922 8:1762683-1762705 GACTGTTTTGGGGATTAAATAGG - Intronic
1044027342 8:87189821-87189843 GACTGATTAGGGAATTCAAATGG + Intronic
1044923440 8:97188959-97188981 GCCTGATGAGGGGCTTTACTTGG + Intergenic
1049688566 8:143949081-143949103 GACTTGTTAGGGGCTTGCCTTGG - Intronic
1053159818 9:35806200-35806222 GACAGATTAAGGGCTTCATTCGG + Exonic
1053170995 9:35883286-35883308 GACTGGTTAGGGGCTCTAACTGG + Intergenic
1055058912 9:72048838-72048860 GAATGGATAGGGGCTTGAGTGGG + Intergenic
1055672324 9:78619869-78619891 CACTGAAAAGGGGGTTGAATGGG + Intergenic
1057954411 9:99396283-99396305 GACTGATAAGGGACTTGATGTGG + Intergenic
1186543343 X:10423260-10423282 TAATGATTAGGGGCTTGCAATGG + Intergenic
1190008262 X:46759725-46759747 GACTGATAAGGAGTTGGAATCGG + Intergenic
1190592380 X:52017732-52017754 GATTGACTAGGGGCTTGTCTAGG - Intergenic
1194686209 X:96920511-96920533 TACTGATCAGGGAATTGAATTGG + Intronic
1198579346 X:138046590-138046612 GCCTGATTAGGGTCTGGAACAGG + Intergenic