ID: 950500023

View in Genome Browser
Species Human (GRCh38)
Location 3:13357877-13357899
Sequence GCCCCATTTTAACACCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950500013_950500023 23 Left 950500013 3:13357831-13357853 CCCCCACGCCTACTCTGACCCTA 0: 1
1: 0
2: 0
3: 16
4: 181
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500021_950500023 -5 Left 950500021 3:13357859-13357881 CCTGTCCATAGACAGCAAGCCCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500015_950500023 21 Left 950500015 3:13357833-13357855 CCCACGCCTACTCTGACCCTACA 0: 1
1: 0
2: 0
3: 2
4: 77
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500016_950500023 20 Left 950500016 3:13357834-13357856 CCACGCCTACTCTGACCCTACAT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500022_950500023 -10 Left 950500022 3:13357864-13357886 CCATAGACAGCAAGCCCCATTTT 0: 1
1: 0
2: 0
3: 11
4: 129
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500018_950500023 5 Left 950500018 3:13357849-13357871 CCCTACATACCCTGTCCATAGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500019_950500023 4 Left 950500019 3:13357850-13357872 CCTACATACCCTGTCCATAGACA 0: 1
1: 0
2: 1
3: 9
4: 135
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500014_950500023 22 Left 950500014 3:13357832-13357854 CCCCACGCCTACTCTGACCCTAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500020_950500023 -4 Left 950500020 3:13357858-13357880 CCCTGTCCATAGACAGCAAGCCC 0: 1
1: 0
2: 1
3: 13
4: 130
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76
950500017_950500023 15 Left 950500017 3:13357839-13357861 CCTACTCTGACCCTACATACCCT 0: 1
1: 0
2: 1
3: 12
4: 178
Right 950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950500023 Original CRISPR GCCCCATTTTAACACCCTCA AGG Intronic
900608374 1:3533892-3533914 GCCCCACTCTGACACCCTCCAGG + Intronic
908147460 1:61262147-61262169 TCCCCATTGTAGCACTCTCAAGG - Intronic
908463506 1:64369048-64369070 GCCCCATGGAAAGACCCTCATGG - Intergenic
910751723 1:90638219-90638241 GCCCCATTTTAGACCCCTCTTGG + Intergenic
911505558 1:98745475-98745497 GGCCCATTTTAGCACCATCAGGG - Intronic
915271679 1:154758192-154758214 GCCTCTTTTGAACACCCTCTGGG - Intronic
915921930 1:159982280-159982302 GCCCCATCTTGACAGCCACATGG + Intergenic
922542638 1:226430497-226430519 GCTTCATTGTAACACCCTAAGGG + Intergenic
923542751 1:234900468-234900490 GTCTCATTTTCAGACCCTCAGGG + Intergenic
1064141244 10:12792439-12792461 TCCCCATTTCATCACCCCCAAGG + Intronic
1069847190 10:71380440-71380462 GCCTCATTAGAACAACCTCAGGG - Intergenic
1073509142 10:104032437-104032459 GCCCCATTTCAACACCAGCTTGG + Intronic
1075609058 10:123836812-123836834 GCCCCAGTTTCAGCCCCTCAGGG + Intronic
1081282699 11:41229763-41229785 GTGACATTTTAATACCCTCAAGG - Intronic
1083683056 11:64360060-64360082 GCCTCATTTGCACACCCTCCTGG + Intronic
1087044129 11:93830180-93830202 GCCCTATTTGAACATCCTCGTGG - Intronic
1100053605 12:90482057-90482079 GCCCAATTATAATAACCTCAAGG - Intergenic
1106483059 13:30151034-30151056 TCTCCATTTAAACTCCCTCAAGG + Intergenic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1124957100 15:34366933-34366955 GCCCCATTTTCCTATCCTCACGG + Intronic
1125151939 15:36542440-36542462 GTCCCTTTTTATCATCCTCATGG - Intergenic
1128186326 15:65646154-65646176 GCCCCGTCTTTACAGCCTCATGG + Intronic
1131005769 15:88976848-88976870 GCCTCATTCCAACAGCCTCAAGG + Intergenic
1134320760 16:13160679-13160701 GGACCATTTTAACACCCCCCAGG + Intronic
1137877068 16:52006978-52007000 GCCCCCTTTTAACAGCCTGCTGG + Intronic
1142128991 16:88423986-88424008 GCCATATTTTAAAACCATCACGG + Intergenic
1142271499 16:89092041-89092063 ACCCCCTGTTAATACCCTCAGGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1150229987 17:63544487-63544509 GCCCCATTCTAAAACCCACCTGG - Intronic
1152524519 17:80879876-80879898 GCCCCACTTGTTCACCCTCAGGG - Intronic
1156074628 18:33259013-33259035 CCCCCATTTTTAGATCCTCAAGG - Intronic
1162218967 19:9159942-9159964 GCCCCATTTGAGCTCCATCAAGG - Intronic
1165983314 19:39745266-39745288 GCCCCATTTTCAAGCCCCCAGGG - Intergenic
1168134655 19:54342238-54342260 CCACCATTTTATCCCCCTCAGGG + Intergenic
927809863 2:26174891-26174913 GCCCCATCTTCACAGCCACATGG - Intronic
932544872 2:72697920-72697942 GCCCTAACTTAAAACCCTCAGGG + Intronic
933563024 2:83912943-83912965 TCCCCATTGCAACATCCTCAAGG - Intergenic
936175042 2:110212317-110212339 GCCCCATTCTGTCCCCCTCATGG - Intergenic
936235866 2:110742012-110742034 TCCCTATTTTAACACAGTCAGGG - Intronic
938679816 2:133678120-133678142 ATCCCATTTTAACTCCCTCCTGG + Intergenic
941033825 2:160544265-160544287 GCCACATTTTAACAGCATTAAGG - Intergenic
942886151 2:180926539-180926561 TCTCCTTTTCAACACCCTCACGG - Intergenic
944923322 2:204437777-204437799 TCCCCATTTTAAGACCCTTTAGG - Intergenic
946547131 2:220756470-220756492 GCACAATTTTGACACCCGCATGG - Intergenic
1169609274 20:7361139-7361161 ACCCCATTTTCACACACTCCAGG - Intergenic
1179226687 21:39459893-39459915 ACCCCATTTTAATAACCACAGGG - Intronic
1185186663 22:49405011-49405033 GGCCCCTTTCAACACCCTGAAGG - Intergenic
950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG + Intronic
950959884 3:17094374-17094396 GGCCCCGTTAAACACCCTCATGG - Intergenic
952615755 3:35271689-35271711 GGCTCATTTTAACACCTTTATGG - Intergenic
954081636 3:48215663-48215685 GTCCCATATTTCCACCCTCATGG + Intergenic
955964523 3:64374675-64374697 TTCCCATTTTACCAGCCTCATGG - Intronic
957459321 3:80496886-80496908 GACACATTGTAACACCCTCTGGG - Intergenic
959974887 3:112447684-112447706 CACCCATTTTCACTCCCTCAGGG + Intergenic
960921962 3:122756238-122756260 GCCCCATTCTAACAACTGCAAGG - Intronic
963004629 3:140714965-140714987 GCCCCAAATTATCACTCTCATGG + Intergenic
965783281 3:172310551-172310573 TCTCCCTTTTTACACCCTCATGG - Intronic
973277099 4:48321626-48321648 GCTCCCTTTAAATACCCTCAAGG + Intergenic
973576763 4:52297509-52297531 TCCCCATTTTAAGAATCTCATGG + Intergenic
974801850 4:66828371-66828393 GCCCCATGTTACCAGCCTCCTGG + Intergenic
985415248 4:189730016-189730038 GCCCCATCTTCTCACCCCCATGG - Intergenic
988120545 5:26955496-26955518 GCCCCATTCTAAAACCAGCAAGG + Intronic
999178858 5:149654489-149654511 GTCCCATTGTCACACCCTCCTGG + Intergenic
999534495 5:152502454-152502476 GCCACTTTTTCTCACCCTCAAGG - Intergenic
999647979 5:153738011-153738033 GCCCCAGTTTAGCACCCTGGTGG - Intronic
1001858989 5:175036797-175036819 GCCCTATTTAGAAACCCTCAGGG - Intergenic
1005789735 6:29286046-29286068 GCTCCAGTTTTTCACCCTCAAGG + Intergenic
1021285764 7:18779247-18779269 GCTCCATTTCAAGACTCTCAGGG + Intronic
1023729355 7:43175851-43175873 ACCTCATTTTAACACCCTCTCGG + Intronic
1025875460 7:65476839-65476861 ATTCGATTTTAACACCCTCAGGG + Intergenic
1031132957 7:117854634-117854656 TGCCCATTTTAACAACTTCAGGG - Intronic
1039602444 8:38851573-38851595 GCCCCCTTTTAACTTCCTCTTGG + Exonic
1040105190 8:43537689-43537711 GCCCCCTTTTAGTGCCCTCAAGG + Intergenic
1045890691 8:107153377-107153399 GCCCAAATGGAACACCCTCAAGG - Intergenic
1049782239 8:144434356-144434378 GCCCCTTTTCAACAGCCCCAGGG + Intronic
1185792297 X:2936707-2936729 GCCCCTTCCTAACACCCTTAGGG - Intronic
1187528428 X:20074749-20074771 GCCTCATTTTAACACTGTTAAGG - Intronic
1189511107 X:41662488-41662510 GCCACATTTCATCACCCTAATGG - Intronic
1201274783 Y:12287067-12287089 TTCCAATTTTAACATCCTCAGGG - Intergenic