ID: 950500681

View in Genome Browser
Species Human (GRCh38)
Location 3:13361677-13361699
Sequence CTGTTTGAAGGGAGAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950500681 Original CRISPR CTGTTTGAAGGGAGAGTAGA TGG (reversed) Intronic
903383481 1:22912383-22912405 CTGTTTGCAGGGAGCGTGCAGGG - Intronic
903847280 1:26285823-26285845 CTGTGTGGAGGGATCGTAGAAGG + Exonic
905510954 1:38519737-38519759 CAGGCTGAAGGGAGAGGAGAAGG + Intergenic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907240630 1:53079092-53079114 CTGTCTGAAGGGTGAGGAGAAGG + Intronic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
909077024 1:71061408-71061430 CTGTTAGAGGGGAAAGTAGATGG - Intergenic
909325441 1:74346280-74346302 GTGTTTGGAGAGACAGTAGATGG + Intronic
909607358 1:77520574-77520596 CTGTATGAAGGGAGAGCATCAGG - Intronic
911522069 1:98941120-98941142 CTGTTGGAAGGGATAACAGAGGG + Intronic
912233227 1:107819714-107819736 CAGTTTGAAGGAAGAGTATTTGG - Intronic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
914417769 1:147499717-147499739 GTGTTTGGAGGGAGAGGTGAGGG + Intergenic
914718220 1:150268686-150268708 CTGGTCGCAGGGTGAGTAGAGGG - Exonic
915016874 1:152742673-152742695 TTGCTTTAAGGGAGAGTACAAGG - Intronic
915192493 1:154163574-154163596 CTGATTGGAGGGAAAGAAGACGG - Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
916025575 1:160830711-160830733 TGGGCTGAAGGGAGAGTAGATGG - Intronic
916530939 1:165655713-165655735 CTGCTGGAAGGGTGAGGAGAGGG - Intronic
916658144 1:166896261-166896283 CTATTTGGAGGAAGAGCAGATGG + Intergenic
917210227 1:172623691-172623713 CTATTTGAAGGGAAAAAAGATGG - Intergenic
917999571 1:180479575-180479597 ATGTTTGATAGCAGAGTAGAGGG + Intronic
918412100 1:184270632-184270654 CTGCTTGAAGGGAGATCTGAGGG - Intergenic
919757614 1:201075616-201075638 CTGTATGGAGGGAGGATAGAGGG + Intronic
919775492 1:201191604-201191626 CTGTTGGATTGGAGACTAGAGGG - Intronic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
920439802 1:205972435-205972457 CTGTGATAAGGGAGAGTAGGGGG + Intergenic
921914882 1:220596216-220596238 ATGTTTAAAGGTTGAGTAGAAGG + Intronic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
923987090 1:239393494-239393516 TTGTGTGAAGGGAGAGGTGATGG + Intronic
924329333 1:242926411-242926433 GTCTTTGAACGGAGAGTAGAGGG - Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1065178883 10:23105361-23105383 GTGTTTGATGGCAGAGTAGGAGG - Intronic
1065186778 10:23175963-23175985 CTGTTTGCAAGGAGAATAAAGGG + Intergenic
1065215259 10:23441597-23441619 CTCTTTTAAGGGATAGTAGCAGG + Exonic
1066435365 10:35392642-35392664 CTGGTTGAAAGCAGAGGAGAGGG + Intronic
1066700746 10:38125494-38125516 CTGCATGGAGGGAGAGGAGATGG + Exonic
1066752526 10:38673025-38673047 CTGTCTGGAGGGAAAATAGAGGG - Intergenic
1066964507 10:42250011-42250033 CTGTCTGGAGGGAAAGTAGAGGG + Intergenic
1068704139 10:60054552-60054574 TTGTTAGAAGGGAGAGTAAGAGG - Intronic
1068730200 10:60349760-60349782 CTATTAGAAGGGAGAACAGAGGG - Intronic
1069321042 10:67172003-67172025 CAGTTTGGAGGAAAAGTAGAGGG - Intronic
1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG + Intergenic
1072004657 10:91232816-91232838 GGGTTTGAAGAGAGAGGAGAAGG + Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1075619628 10:123916257-123916279 CTGGATGAAGCGAGAGTAGGTGG + Intronic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1077365655 11:2160511-2160533 TTGTTTGAGGGGCGAGTGGAGGG + Intronic
1079324763 11:19482234-19482256 CTTTTTGTAGGGAACGTAGATGG - Intronic
1079393041 11:20038903-20038925 CTGATTGAAAGAAGAGGAGACGG + Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1080853672 11:36093114-36093136 CTTTATGATGGGAGAGTAAAAGG + Intronic
1080896042 11:36449478-36449500 CAGTTTGAAGGCAGAGCACATGG - Intronic
1081245338 11:40759325-40759347 ATGTGTGAAGGGAAAGTAAATGG - Intronic
1082985788 11:59170197-59170219 CTGTTTGAAAGGCGAATGGAAGG - Intergenic
1083436696 11:62647948-62647970 CTGTTTGGTGGGCAAGTAGATGG - Exonic
1084756196 11:71240392-71240414 CTGTTTGGAGGAACAGGAGAGGG - Intronic
1085204743 11:74724580-74724602 ATGTTTGAAGGCACAGTAGGAGG - Intronic
1085299408 11:75449611-75449633 CTGTTTGCAGGGAGAGGGAAGGG + Intronic
1086245888 11:84752428-84752450 GTGTAAGAAGAGAGAGTAGAAGG + Intronic
1087562722 11:99812006-99812028 CTGTATGATGGGAGAATAAATGG + Intronic
1087562903 11:99814400-99814422 CTGTATTATGGGAGAGTAAATGG + Intronic
1088506825 11:110535245-110535267 CAATTTGGATGGAGAGTAGAAGG + Intergenic
1089439776 11:118505607-118505629 ATGTTTGAAGGGGTACTAGAGGG - Exonic
1090299481 11:125623124-125623146 CTGTTTGTAGGGGGTGTAGATGG + Intronic
1091621316 12:2091513-2091535 CTCTTTGCAGGTAGAGGAGAGGG - Intronic
1091874913 12:3925709-3925731 CTGTTTGAAGGGGGACCAGAAGG - Intergenic
1092043174 12:5403618-5403640 CTATTTTAAGGGATAGAAGATGG + Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092479202 12:8844939-8844961 CTGTTTCAAGTGAGAGTGGACGG + Intronic
1095948897 12:47770809-47770831 AAGTTTGAAGGTAGAGTAGCGGG - Intronic
1096578930 12:52572005-52572027 CTGCCAGCAGGGAGAGTAGATGG + Intronic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097430580 12:59500176-59500198 CTGGGTGAAGAGAGAATAGAGGG - Intergenic
1097499516 12:60384516-60384538 CTGTTGGGAGGGAGAGTATCAGG + Intergenic
1097806695 12:63972469-63972491 CTGATTGCAGGGAGTGGAGAAGG + Intronic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1104176842 12:126341316-126341338 GTGTTTTAAGGGAAAGGAGATGG + Intergenic
1104654927 12:130567501-130567523 CTGCCTGAAGGGACACTAGAGGG + Intronic
1105448117 13:20474966-20474988 CTGTTAGAAGCTAGAGTGGATGG - Intronic
1105573059 13:21622390-21622412 CTTTATGAAGGGAGAAGAGATGG + Intergenic
1105888818 13:24667121-24667143 CTCTTTTGAGGGAGAGTAGGGGG + Intergenic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107988885 13:45799699-45799721 CTGCTTGCAGGGAGAGGAGCGGG - Intronic
1108109091 13:47048034-47048056 GTATTTGAAGCAAGAGTAGAAGG - Intergenic
1109176548 13:59164872-59164894 CTATTTGAAGGAAGAGTATCAGG - Intergenic
1109981409 13:69913187-69913209 CAGTTTGAAGGGGGAGCATAGGG - Intronic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1112187173 13:97138493-97138515 TAGTTTGATGGGAGAGTGGAGGG - Intergenic
1112617491 13:101020348-101020370 GTGATTGGAGGGAGAGTTGAAGG - Intergenic
1112946126 13:104929154-104929176 CTGTTTGGAGTGAGAGGTGATGG + Intergenic
1114417006 14:22551658-22551680 CTGTTTGGAGAGGGAGAAGAGGG - Intergenic
1116552720 14:46262850-46262872 CTATGTGAAGGGATAGTAGCAGG + Intergenic
1116934154 14:50720695-50720717 ATTTGTGAAGGGAGAGTAGAAGG - Intronic
1117002979 14:51390537-51390559 TTGTTTGAATGGAGAGTAGAAGG - Intergenic
1117841812 14:59869406-59869428 CTGTTTCCAGGGAGAGGAAAGGG - Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1119445477 14:74659847-74659869 CTATGTGAAGCCAGAGTAGAGGG + Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1120897974 14:89551385-89551407 CGGGTTGAAGGGATAGTGGATGG - Intronic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1125968228 15:43891343-43891365 CTGTTAGATGGGAGTGGAGAAGG + Intronic
1126059318 15:44764325-44764347 CTGTATAGAGGGAGAGTATATGG - Intronic
1127829743 15:62739803-62739825 CTATTTGGAGGGAGGGTAGGAGG + Intronic
1127876010 15:63111995-63112017 ATGTTTAAAGATAGAGTAGAAGG - Intergenic
1131515625 15:93074378-93074400 AAGTTTGAAGGGAGGGGAGAAGG + Intronic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131791803 15:95973285-95973307 CAGTTAGATGGGAGACTAGAGGG + Intergenic
1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG + Intergenic
1136730199 16:32404005-32404027 CTGCCTGGAGGGAAAGTAGAGGG + Intergenic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1141331274 16:83113688-83113710 GTGCTTGAGTGGAGAGTAGAAGG + Intronic
1202996202 16_KI270728v1_random:113303-113325 CTGTCTGGAGGGAAAGTAGAGGG - Intergenic
1203022889 16_KI270728v1_random:425645-425667 CTGTCTGGAGGGAAAGTAGAGGG - Intergenic
1142912129 17:3103131-3103153 CTGATGGGAGGGAGGGTAGAGGG + Intergenic
1147461908 17:40577930-40577952 CTTTATGGAGGGAGAGTATAGGG + Intergenic
1148731613 17:49840136-49840158 GTTTGTGAAGGGAGAGCAGAGGG - Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1151598571 17:75092906-75092928 CTGTTTGAAAGGAGTGTTGCAGG + Intronic
1152526436 17:80890626-80890648 CAGGCTGAAGGGAAAGTAGACGG + Intronic
1153403029 18:4702114-4702136 CTGTTTGAAGGCAGATAACATGG - Intergenic
1154130531 18:11733311-11733333 CAGTTTAAAGGGTGAGCAGAGGG - Intronic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1155184692 18:23376871-23376893 CTGTTTAAAAGGAGACTAGCAGG - Intronic
1155633526 18:27923384-27923406 CTGTTTTAAGGGTGAGCAGATGG + Intergenic
1155803032 18:30132688-30132710 CTATTTGAATGGAGACTATAGGG + Intergenic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1156842364 18:41624367-41624389 CTTTTTGAAAGGAGTGTGGATGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157533330 18:48440538-48440560 AGGTTTTAAGGGAAAGTAGAGGG + Intergenic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158558169 18:58492109-58492131 CTGTTTGAAGGCAGAGGGGAAGG - Intronic
1158804234 18:60950301-60950323 ATGTTTGATAGTAGAGTAGAAGG - Intergenic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159995578 18:74960910-74960932 CTGGGTGAAGGGATAGGAGAAGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162028472 19:7907263-7907285 GTGTTGGGAGAGAGAGTAGATGG + Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1163186790 19:15644489-15644511 ATGTTTGAAAGGAGAGTGCAGGG + Intronic
1163218018 19:15895054-15895076 ATGTTTGAAAGGAGAGTGCAGGG - Intronic
1163838023 19:19587925-19587947 CTGGGTGAAGGGAGAGGAGGGGG + Intronic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1165968228 19:39602879-39602901 GTGTGTGAATGGAGAGTAAAGGG + Intronic
1166732519 19:45067188-45067210 CATTTTGGAGGGAGAGTAGCAGG + Intronic
1168630627 19:57953531-57953553 CTGCTGGAAGGGTGAGTACATGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
929558456 2:42940232-42940254 ATATTTGAAGAGTGAGTAGAAGG + Intergenic
930050146 2:47208979-47209001 CTGTTTGAGTGGAGAATGGAAGG - Intergenic
930149213 2:48041255-48041277 CTGTTGGAGGGGTGAGTGGAGGG - Intergenic
930303840 2:49652661-49652683 CAGTCTGAAGGAAGAGTAGAGGG - Intergenic
933743143 2:85550696-85550718 CTGTTGGAAGGGGAAGTAAAAGG - Exonic
934186502 2:89682059-89682081 CTGTCTGGAGGAAAAGTAGAGGG + Intergenic
934315514 2:91915171-91915193 CTGTCTGGAGGGAAAGTAGAGGG - Intergenic
935554815 2:104498006-104498028 CTATTTGAGGGGAGAGTAAGGGG + Intergenic
937080772 2:119138001-119138023 CAGTTTGAAGGAAAAGTAGAAGG + Intergenic
937159316 2:119745445-119745467 GTGGTTGAAGAGAGAGTACATGG + Intergenic
937768811 2:125694923-125694945 CTGGCTGCAGGGAGAGAAGAAGG + Intergenic
937989794 2:127655824-127655846 CTGTTTCAAGGTAGAGCTGATGG - Intronic
946730028 2:222700456-222700478 CTGTTTGCAGGGTAAGTAGAGGG - Intronic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
1169102710 20:2965437-2965459 GTGTTTAAAGGTAGAGAAGAAGG + Intronic
1169481630 20:5987611-5987633 CTGGGTGAAGGGCGAGTAGGTGG - Intronic
1169656181 20:7926226-7926248 CTGTTTGACAGTAGAGAAGAAGG - Intronic
1169930707 20:10829706-10829728 CTTTTGGAGGGCAGAGTAGAGGG + Intergenic
1170993069 20:21323022-21323044 GTGGGTGAAGGGAGAGGAGAGGG + Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1177599760 21:23295426-23295448 CTGCTTGGAGGGAGAGAATAAGG + Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1180542285 22:16461056-16461078 CTGTCTGGAGGGAAAGTAGAGGG - Intergenic
1181855950 22:25781715-25781737 TTGTCTGCAGGGAGAGAAGAGGG - Exonic
1181867186 22:25868115-25868137 GTGTATGAAGGCAGAGTGGATGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182036371 22:27201565-27201587 ATGTGAGATGGGAGAGTAGAGGG - Intergenic
1183240237 22:36652413-36652435 ATGTTTGCAGGGTGAGAAGAAGG - Intronic
1183420732 22:37709897-37709919 CAGTTTGATGGTAGAGGAGATGG - Intronic
1183968785 22:41460239-41460261 CTGGGTGAAGGGAGAGGAGGGGG + Exonic
1184262074 22:43323784-43323806 CTGTTTGGAGGGATATTTGAAGG - Intronic
949683850 3:6546213-6546235 CTTTTGGATGGGAGAGGAGATGG - Intergenic
950400409 3:12765494-12765516 CCGTTTGAAGAGAGACAAGAAGG + Intronic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
950565093 3:13764623-13764645 CTGTTTCAAGGCAGTGTAGAGGG + Intergenic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
951082089 3:18464587-18464609 CTGTTAGAAGAGAGTGTGGAAGG - Intergenic
952995755 3:38880605-38880627 CTGTTTGTAGGGATAGATGAGGG - Intronic
953327567 3:42025535-42025557 CTGTTCAAAGGGAGAGGGGAAGG + Intronic
953492961 3:43365392-43365414 CTGTTTGCTGGGAAAGGAGAGGG - Intronic
953770086 3:45772881-45772903 CAGGTTGAAGGGAGGGTGGAAGG - Intronic
954689362 3:52387559-52387581 CTGTCTGATGGAAGAGGAGAAGG - Intronic
954946133 3:54425811-54425833 CTGTTAGAAGGCAGAGCAGTGGG - Intronic
955190419 3:56756481-56756503 TTGTTTGAAGGGAGTACAGAGGG - Intronic
955342478 3:58135814-58135836 TTTTTGGTAGGGAGAGTAGAGGG - Intronic
955468520 3:59261740-59261762 GTGTTTGAATGGACAGTGGAGGG + Intergenic
956841500 3:73144173-73144195 CTGTTTGAGGGGAGAGGACTTGG + Intergenic
956939952 3:74146957-74146979 CAGTTTGGAGGGAGGGTAGTGGG - Intergenic
959669942 3:108965053-108965075 CTGCCTGAAGGTGGAGTAGAAGG + Intronic
960008640 3:112808932-112808954 ATGATGGAAGGGAGAATAGAAGG - Intronic
960268377 3:115647564-115647586 CAGTATGAAGGGAGAGTAGAAGG + Intronic
960396501 3:117144049-117144071 CTGTTTGGATGGACAGTTGAAGG + Intergenic
962631220 3:137278032-137278054 ATGTTTGAAGGGAGAGGAAAAGG + Intergenic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
963781836 3:149494212-149494234 GAGTTTGAAGGGAGAGAAGAAGG + Intronic
964379838 3:156087359-156087381 CAGTGTGAAGGAAAAGTAGAGGG - Intronic
964761456 3:160138265-160138287 CTGTTTGAATGGAGGGTAACTGG + Intergenic
965284225 3:166796576-166796598 TTGAGTGAGGGGAGAGTAGAGGG + Intergenic
966282826 3:178254648-178254670 CTGCCTGATGGGAGAGTACACGG - Intergenic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
967675766 3:192297067-192297089 CTGGTAGAAGGGATAGTAAAGGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969550430 4:7862708-7862730 ATGTTTCAAGGGATAGCAGAGGG - Intronic
970164150 4:13218529-13218551 CATTTTAAAGGGAGAGTAGGCGG - Intergenic
972039693 4:34577303-34577325 CTGTTTCAAGGGAGACAACAGGG - Intergenic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
973556077 4:52084265-52084287 ATGCTTGATGGGAGAGAAGAAGG - Intronic
975918548 4:79355109-79355131 ATGTTTGATAGCAGAGTAGAGGG + Intergenic
976620917 4:87126478-87126500 CTTTTTGGAGGGAGAGTAAAAGG + Intronic
977078408 4:92489141-92489163 CTGTTTGTAGTTACAGTAGAAGG - Intronic
977925343 4:102694295-102694317 CTATTTGAAAGAAGAGGAGAGGG - Intronic
977947756 4:102933246-102933268 CTGTCTGGAGGGAAAGTAGAGGG - Intronic
978415130 4:108466810-108466832 TTGTCTAAAGAGAGAGTAGAGGG - Intergenic
978636980 4:110821382-110821404 CTGTTTGCAGGGACAATGGATGG + Intergenic
980063286 4:128155277-128155299 CTGTGTGAAGGCACAGTAGAGGG + Intronic
980382264 4:132037874-132037896 CTGTTTAAAGGAAGAATAGCAGG - Intergenic
980697948 4:136384015-136384037 CTGTTTGGAAGGGGAATAGATGG - Intergenic
980959461 4:139460554-139460576 CTGTTTTAAGGTAGGGTATAAGG - Intronic
981842369 4:149127499-149127521 CACACTGAAGGGAGAGTAGATGG + Intergenic
982539256 4:156647071-156647093 ATGTTTGAAGTGAGAGAGGAAGG - Intergenic
984617442 4:181914647-181914669 ATGTTTGAAGGCAGAACAGAAGG + Intergenic
984920137 4:184756598-184756620 CTGTGAGAAGGGACAGTAGCAGG + Exonic
985199881 4:187474112-187474134 GTGTTTGAATGGAGAGTCCATGG + Intergenic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
987069315 5:14321178-14321200 CTGTTTGAAGGATGAGGAGAAGG + Intronic
987667990 5:20969584-20969606 TTGTTTGAAGAGAGAATAGCAGG - Intergenic
988467393 5:31503420-31503442 TTCCTTGAAGGGAGACTAGATGG - Intronic
989046190 5:37276026-37276048 CTGTTTGAAATGTGAGTAAATGG + Intergenic
989095142 5:37775087-37775109 CTGTTTGACAGGATAGTAAAGGG + Intergenic
990237056 5:53779694-53779716 CTGTTGGAAGGGAGAGGAAGTGG + Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
995687337 5:114785028-114785050 CTATCTGAAGGGAGTGTGGATGG - Intergenic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
995835158 5:116393607-116393629 ATATTTGAAGGGAGATTAAAAGG + Intronic
997178774 5:131805981-131806003 CTGCTTGAAGGCAGAGAAGAGGG + Intergenic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
997470862 5:134115951-134115973 CAGATTGAAGGCGGAGTAGACGG - Exonic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
999361506 5:150990040-150990062 GTGTTGGAAGGGGGAGAAGAGGG + Intergenic
1002990525 6:2234188-2234210 CTGTTTGAGAGGAGAATAAAAGG - Intronic
1003435611 6:6085128-6085150 GTCTTTGAAGGGACAGTAGCAGG + Intergenic
1004401546 6:15293440-15293462 CTCTTTGAAGGGACAGATGAAGG + Intronic
1008893453 6:56523455-56523477 AAGTTTGAAGGGAGAACAGAAGG - Intronic
1012133887 6:95531329-95531351 GTGTTTGAAGGGAAAAAAGATGG - Intergenic
1012686229 6:102253418-102253440 CTGTTCAAAGGGAGAAAAGATGG - Intergenic
1013054507 6:106570481-106570503 CTCTTTGAAGGGTGAGATGAGGG - Intergenic
1013396709 6:109748082-109748104 AGGTTTGAAGGGAGTGGAGAAGG + Intronic
1013741232 6:113288350-113288372 ATTTTTGAAGGGAGAGAATATGG + Intergenic
1015769548 6:136754615-136754637 CTGTTTGAAGGTGGATTATAGGG + Intronic
1016708121 6:147137687-147137709 CTGTTTGAACAGAGAGTAAATGG + Intergenic
1016905817 6:149149846-149149868 CATTTTGAAGGTAGAGTAGATGG + Intergenic
1017042987 6:150322777-150322799 CTGCTTGCAGGGTGAGGAGAGGG - Intergenic
1017195118 6:151692231-151692253 GTGTTTGAAGGGAAGGTAGATGG - Intronic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019648722 7:2144721-2144743 CTGTGTGAAGCGTGAGCAGAGGG + Intronic
1020440759 7:8214346-8214368 CTCTTTGAAGGCAGAGTAAAAGG - Intronic
1022791475 7:33693461-33693483 GAGTTTGATGGGAGAGTAGGGGG + Intergenic
1022796938 7:33739389-33739411 CTGTTTGATGTGAAAATAGAGGG + Intergenic
1029836468 7:103317451-103317473 ATGTTTGAAGGTAGTCTAGAAGG - Intronic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033467317 7:141606359-141606381 CTGTTTGAAAGAATAGTATATGG - Intronic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1036468049 8:9021205-9021227 CAGTTTGAATGGAGAGTAAGGGG - Intronic
1036734619 8:11300077-11300099 ATGTTTGAAGTGATAGAAGATGG + Exonic
1037076800 8:14730608-14730630 CTGCTTGAAGTGAGAGCACATGG + Intronic
1038776151 8:30532732-30532754 CTCTTTGGAGGGTGAGGAGATGG - Intronic
1038960193 8:32509897-32509919 CTGAATGAAAGGAGAGTAAAAGG - Intronic
1039578851 8:38647518-38647540 CTGATTGAAAGGACGGTAGAAGG - Intergenic
1040721573 8:50330493-50330515 CAGTTTGGAGGGTGAGAAGAAGG - Intronic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1043282321 8:78483695-78483717 ATGTTTGCAGGGAGAGTGAAAGG - Intergenic
1044192526 8:89335754-89335776 ATTTTTGGAGGTAGAGTAGAAGG - Intergenic
1044948297 8:97411983-97412005 TTATTTGAAGGGAGAGAAAATGG - Intergenic
1046880580 8:119302845-119302867 CTGTTTTAAGGGACAGAAAATGG - Intergenic
1047197987 8:122738888-122738910 CTGTCTGAAGGGAGAGAAATTGG - Intergenic
1048177714 8:132168158-132168180 CAGTTCGAAGGGGGAGTAGAAGG - Intronic
1049109467 8:140634579-140634601 CTTTTTAAATGCAGAGTAGAAGG - Intronic
1053019245 9:34683573-34683595 CTATTTGCAGGGAATGTAGAAGG - Intergenic
1053096099 9:35329381-35329403 CCATTTGAAGGCAGAGAAGATGG + Intronic
1056104561 9:83334061-83334083 CTGTTTGAATTGATAGGAGATGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058091082 9:100806162-100806184 CTTTTTGAAGGGATAAAAGATGG + Intergenic
1058532016 9:105915572-105915594 TTAGTTGAAGGGAGAGTTGAAGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059573177 9:115462456-115462478 CTGAATGAAGTGAGAGTAGCCGG + Intergenic
1060027476 9:120185291-120185313 GTCTTTGAAGGGAGAGTTGGGGG - Intergenic
1060048767 9:120361627-120361649 CTCTTTGAAGGCAGAATAAAAGG - Intergenic
1060074394 9:120579010-120579032 CTGGTTGGAGAGTGAGTAGAGGG - Intronic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1185480969 X:445986-446008 CTGTTTGGAGAGGGAGTAGCTGG + Intergenic
1187754560 X:22508195-22508217 CTGTTGGAAGTGACAGGAGAGGG - Intergenic
1188335446 X:28926746-28926768 AGGTTTGAAGAGAGAGAAGAAGG - Intronic
1188403164 X:29772779-29772801 CTGTTGGAAATGAAAGTAGAAGG - Intronic
1189055481 X:37695080-37695102 CAGATTCAAGGGAGAGGAGAGGG + Intronic
1189724793 X:43957550-43957572 GTTTTTGAATGGAGAGTGGAGGG + Intronic
1190388679 X:49910539-49910561 AGGCTTGAAGGGAGAGGAGAAGG - Intergenic
1190842029 X:54154211-54154233 ATTTTTGAAGGGAGAGCTGATGG + Intronic
1190968137 X:55322610-55322632 TTGTTTGAAGGGATTGTAAATGG + Intergenic
1190992291 X:55565150-55565172 CTGCTTGACTGGAGAGTGGAGGG - Intergenic
1192200985 X:69066577-69066599 CTGGTTGAAGGGAGAGTAGGAGG + Intergenic
1192404338 X:70869269-70869291 ACGTTTGAAGGTAGAGAAGAAGG - Intronic
1195758673 X:108223825-108223847 CTGCTTGATGGGAGAATGGAGGG + Intronic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1196036976 X:111156082-111156104 CTGGATGAAGGGAGACTAGTAGG + Intronic
1198617394 X:138474395-138474417 GTGTTTGGAATGAGAGTAGAGGG + Intergenic
1199093625 X:143716980-143717002 GTGTTGGAAGGGGGAGGAGAGGG - Intronic
1199208880 X:145182765-145182787 CTTCCTGATGGGAGAGTAGATGG + Intergenic
1199214709 X:145251180-145251202 GTGTTGGAAGGGGGAGGAGAGGG + Intronic
1201183179 Y:11369993-11370015 CTGTCTGGAGGGAAAGTAGAGGG - Intergenic
1201226699 Y:11825530-11825552 GTCTTTGAACGGAGAGTAGAGGG - Intergenic