ID: 950502320

View in Genome Browser
Species Human (GRCh38)
Location 3:13372351-13372373
Sequence TGTGCTGAAGTGCACTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950502310_950502320 25 Left 950502310 3:13372303-13372325 CCCTGCAGCACCTACCAGGCCAG 0: 1
1: 0
2: 2
3: 33
4: 262
Right 950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 200
950502311_950502320 24 Left 950502311 3:13372304-13372326 CCTGCAGCACCTACCAGGCCAGC 0: 1
1: 0
2: 2
3: 40
4: 352
Right 950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 200
950502318_950502320 0 Left 950502318 3:13372328-13372350 CCTTGGAGGAACATGGAGTCCAG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 200
950502313_950502320 15 Left 950502313 3:13372313-13372335 CCTACCAGGCCAGCACCTTGGAG 0: 1
1: 0
2: 4
3: 17
4: 212
Right 950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 200
950502315_950502320 11 Left 950502315 3:13372317-13372339 CCAGGCCAGCACCTTGGAGGAAC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 200
950502317_950502320 6 Left 950502317 3:13372322-13372344 CCAGCACCTTGGAGGAACATGGA 0: 1
1: 0
2: 2
3: 6
4: 254
Right 950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950502320 Original CRISPR TGTGCTGAAGTGCACTGTGC AGG Intronic