ID: 950504379

View in Genome Browser
Species Human (GRCh38)
Location 3:13385204-13385226
Sequence GAGTGGTGTCTCCAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950504379 Original CRISPR GAGTGGTGTCTCCAGTTGAT GGG (reversed) Intronic
901844796 1:11975024-11975046 GAATGGTGTCTCCAGGGGCTGGG - Exonic
905929833 1:41779228-41779250 GAGAGGTGTCTGCAGTGGAGTGG + Intronic
910841021 1:91561308-91561330 GAGGGGTGTTTCTACTTGATGGG - Intergenic
911767396 1:101694215-101694237 GAGTGTTTTCTGCAGTTGTTGGG + Intergenic
922248197 1:223821009-223821031 TTGTGGTGTCTCCATTTTATTGG + Intronic
922929991 1:229381465-229381487 GAGTGGTGTTTCCTGATGACTGG - Intergenic
1064951617 10:20857353-20857375 GATAGTTGTCTTCAGTTGATGGG - Intronic
1070593079 10:77813938-77813960 CAATGGTGTCTCCAGTTGAGGGG + Intronic
1071976590 10:90962165-90962187 GAGCGGTGTCTTGAGTTGATAGG + Intergenic
1074636533 10:115324719-115324741 AGATAGTGTCTCCAGTTGATAGG + Intronic
1077333158 11:1992213-1992235 GAGCGGGGTCTCCACTTGGTGGG - Intergenic
1202816140 11_KI270721v1_random:47392-47414 GAGCGGGGTCTCCACTTGGTGGG - Intergenic
1095117660 12:38374687-38374709 GAGTGGTGTTTCTAGTCAATAGG - Intergenic
1099980047 12:89588862-89588884 TTGTGGGCTCTCCAGTTGATAGG + Exonic
1103076489 12:117986936-117986958 CAGTGGTGTCTCCAGTCGCCTGG - Intergenic
1107249500 13:38341405-38341427 GAGTGGGGACTCTAGTTGCTTGG + Intergenic
1108978716 13:56483138-56483160 GAGTGTTGTCGCCAGTGGATGGG - Intergenic
1109117145 13:58402601-58402623 CAGTGGAGACTCCAGATGATAGG - Intergenic
1113310342 13:109125752-109125774 GAGTGGTATCTCCATTTTTTGGG - Intronic
1114853741 14:26412705-26412727 GAGTGGTCCATCCAGTTGGTTGG + Intergenic
1114863230 14:26553656-26553678 GACTTGAGCCTCCAGTTGATGGG + Intronic
1115526258 14:34283582-34283604 GAGTGGGGTTTCCCCTTGATGGG + Intronic
1116154443 14:41185735-41185757 GTGTGGTTTTTCCAGGTGATCGG + Intergenic
1117274018 14:54174191-54174213 GAGTGGTCTCTCCACGTGACTGG - Intergenic
1121652419 14:95568923-95568945 GAGTGGTGTTTCCATTTGTGTGG + Intergenic
1126145650 15:45470702-45470724 GGGTGGTGGTTCCAGTTTATAGG + Intergenic
1126653206 15:50947557-50947579 AAGTGGTGTCTTCTGTTGTTTGG + Intronic
1134263423 16:12672640-12672662 TAGTGGTGGCTCCAGGTGAGGGG + Intronic
1137830552 16:51539398-51539420 GGTTGGAGTCACCAGTTGATGGG - Intergenic
1138874551 16:60933920-60933942 GAGAGATGTGTCCAGATGATAGG + Intergenic
1139794751 16:69473431-69473453 GAGTTCTGGCTCCAGTGGATGGG + Intergenic
1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG + Intergenic
1144316768 17:14069441-14069463 GCGTGGTGTCTGGAGGTGATCGG - Intergenic
1147480847 17:40761577-40761599 CAGTGGGGTCTATAGTTGATAGG + Intergenic
1148398702 17:47333784-47333806 GATTGGTGTGTCCTATTGATTGG + Intronic
1148443573 17:47724574-47724596 CAGTGCTGTCTCCAGCTGAGTGG - Intergenic
1149006584 17:51812483-51812505 CTGTGCTTTCTCCAGTTGATTGG + Intronic
1149436645 17:56639116-56639138 GAGTGATTTCTCCACTTTATAGG + Intergenic
1152609990 17:81310650-81310672 GAATGGTGTCTGCCTTTGATAGG + Intergenic
1154029759 18:10743329-10743351 AAATGGTGTCTCCATTTGCTTGG + Intronic
1158580709 18:58679921-58679943 GAGTGGTGGCTCCAGCTCTTTGG + Intronic
1159274108 18:66193490-66193512 GAGTGTTGTTTCCAGTGGACTGG - Intergenic
1160088341 18:75801277-75801299 CAGTGGGGTCTCCTATTGATCGG + Intergenic
1160494495 18:79364482-79364504 GAGTTGTGTCTGCAGCTGTTGGG + Intronic
1163028714 19:14529438-14529460 GATTGGTCTCGCAAGTTGATTGG + Intronic
1163508408 19:17721327-17721349 GACTGGTGTGTCCAGTGGAAGGG + Intronic
1165282006 19:34805742-34805764 GGGTGGTTTCTGGAGTTGATGGG - Intergenic
1167483806 19:49748448-49748470 GAGTGGGGTCAACAGTGGATTGG - Exonic
1167809591 19:51816816-51816838 CAGTGGTGTCTCCAGAGAATTGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
930219288 2:48729310-48729332 CAGTGGTGTCCCCAGTTGTTGGG - Intronic
931873075 2:66482332-66482354 GATTGGTGTCTCTATTTCATAGG + Intronic
942852372 2:180504093-180504115 AAGTGCTGTCTCCAGTTTGTGGG + Intergenic
946457695 2:219841330-219841352 AAATGGTGTCTCTAGTTGGTGGG + Intergenic
1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG + Intergenic
1172803173 20:37592409-37592431 TATTAGTGTCTCCAGTTTATGGG - Intergenic
1179016558 21:37598592-37598614 GAATGGTGTTTCCATTTGCTGGG - Intergenic
1185180460 22:49357830-49357852 CAGGGGTGTCTCTATTTGATTGG - Intergenic
950504379 3:13385204-13385226 GAGTGGTGTCTCCAGTTGATGGG - Intronic
953571135 3:44072795-44072817 AAGTGGTGTCTCCATGTGCTGGG - Intergenic
955538265 3:59947731-59947753 GAGTGTTGTTTCCAGAAGATGGG - Intronic
962500695 3:135988691-135988713 GACTGGTGTCTTCAGTGGGTGGG - Intronic
963169972 3:142240854-142240876 AAGTGGTGTCGGCAGTTGAGAGG - Intergenic
964568070 3:158080209-158080231 AAGTGGTTTCTCCAGATAATAGG + Intergenic
966731354 3:183153960-183153982 GAGTGGTGTTCCCAGTTGTGTGG + Exonic
966755935 3:183371397-183371419 GAGGGGGGTTTCCAGTTCATAGG + Intronic
971426920 4:26525218-26525240 ATGTGGTCTCTCCAATTGATTGG - Intergenic
972041307 4:34603661-34603683 AAGTGGACTTTCCAGTTGATTGG + Intergenic
980683801 4:136199867-136199889 GAGGGGGGTCTCAAGTAGATGGG + Intergenic
986080116 5:4382643-4382665 AAGTGATATCTACAGTTGATTGG + Intergenic
993627790 5:90246723-90246745 CAGTAGTGTCTCAGGTTGATCGG - Intergenic
1000474254 5:161685898-161685920 GAAAGATTTCTCCAGTTGATTGG + Exonic
1002377917 5:178801447-178801469 GAGTGGGGTCTTCAGTGGAGTGG - Intergenic
1006391290 6:33760443-33760465 GAATGGTGTCTTCAGTGGAGGGG + Intergenic
1007661435 6:43489233-43489255 GAGTTGTTTCTGCCGTTGATGGG + Intronic
1007711664 6:43828119-43828141 GCGTGGTTTCCCGAGTTGATGGG - Intergenic
1009511159 6:64551495-64551517 GAGGGGTCTCTTCAGTTGATTGG - Intronic
1010991060 6:82480348-82480370 TAGTTGAGTATCCAGTTGATAGG + Intergenic
1011815265 6:91182004-91182026 GAATGGTGTTTCCAGATTATTGG + Intergenic
1019404005 7:873320-873342 GAGTAGTGTCTTCACTTGACAGG - Exonic
1019765286 7:2844996-2845018 GAGTGGGGTCTGGAGTTGCTGGG + Intergenic
1020169421 7:5833441-5833463 GGGTGGTCTCAGCAGTTGATCGG + Intergenic
1022679206 7:32528151-32528173 GGGTGGTGTTTCCAGGTCATAGG - Intronic
1024574599 7:50753652-50753674 GTGTGGTGGCTCCATTTGGTGGG - Intronic
1027178348 7:75919470-75919492 GATTGGTGGCTCCAGTTGGTTGG + Intronic
1031858386 7:126949042-126949064 TAGTGTTATCTCCATTTGATAGG - Intronic
1032390303 7:131551601-131551623 GAATCGTGTCTCCAGTTCACTGG - Intronic
1033442098 7:141389367-141389389 GAGTGGTCTGTCTAGTAGATTGG + Intronic
1037373398 8:18203976-18203998 AAGTGGACTTTCCAGTTGATTGG - Intronic
1042059955 8:64805710-64805732 GAGAGGTGTCTACAAGTGATGGG + Intergenic
1045911530 8:107416195-107416217 GATTGGTGTCTGCAGTGGAAGGG - Intronic
1052095207 9:24375323-24375345 GAGTGGTGTAGCTAGCTGATTGG + Intergenic
1055655206 9:78444241-78444263 GAGTGTTGTCTCCAGTGGGGAGG + Intergenic
1057525901 9:95800925-95800947 GACAGGTGTCCCCATTTGATGGG - Intergenic
1058772293 9:108247623-108247645 GAGTGGTGTGTGCAGTGGGTTGG - Intergenic
1190327533 X:49215937-49215959 GAGTGGGGATTCAAGTTGATGGG - Intronic
1197192477 X:123663194-123663216 GAGTGTAGCCACCAGTTGATGGG - Intronic