ID: 950507067

View in Genome Browser
Species Human (GRCh38)
Location 3:13401583-13401605
Sequence AAGCAGGCACAAGCCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950507064_950507067 16 Left 950507064 3:13401544-13401566 CCAGGAAAATAGCATGGCACAGA 0: 1
1: 0
2: 3
3: 31
4: 312
Right 950507067 3:13401583-13401605 AAGCAGGCACAAGCCCACACAGG 0: 1
1: 1
2: 0
3: 12
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950507067 Original CRISPR AAGCAGGCACAAGCCCACAC AGG Intronic
900114333 1:1022030-1022052 AAGCTGGGGGAAGCCCACACTGG - Intronic
900505493 1:3028200-3028222 AGGCAGGCACCAGCCCTCGCAGG + Intergenic
900623668 1:3598640-3598662 CAGCCAGCACCAGCCCACACGGG + Intronic
900673809 1:3871629-3871651 GAGCAGGGACCAGCCCCCACGGG + Intronic
901853080 1:12028463-12028485 AACCATGCACATGCCCACCCCGG + Intronic
905007845 1:34725441-34725463 AAGCAGTCACAAACCTACCCAGG + Intronic
905346242 1:37313014-37313036 GGGCACGCACAAACCCACACAGG + Intergenic
909518773 1:76542927-76542949 AAGCAGAAACAACCCCACAGAGG - Intronic
912691553 1:111808631-111808653 GAGCATGCACAAGCCCTCTCAGG + Intronic
918127217 1:181595355-181595377 CAGCAGGCACATGCACACCCAGG + Intronic
918236844 1:182589307-182589329 AAGCAGCCACAGGCTCACTCTGG + Intergenic
919184133 1:194121823-194121845 AAACAGGCAGAAGGACACACAGG + Intergenic
920132343 1:203742002-203742024 AAGTAGACACAAGCCCTCAAGGG - Exonic
922986601 1:229870696-229870718 AAGCTGCCCCAAGCCCACAGAGG - Intergenic
923685411 1:236150026-236150048 AGGCAGGCACACACACACACAGG - Intronic
924383716 1:243484560-243484582 AAGCAGGCGCAAGCCCTCCCAGG + Intronic
924879434 1:248143930-248143952 AAGAAGGCCCGTGCCCACACAGG - Intergenic
1066177053 10:32918513-32918535 AAGCAGGGACAAACATACACAGG + Intronic
1066457976 10:35588040-35588062 CAGCAGGCCCAGGCCCACCCTGG + Intergenic
1071096349 10:81979704-81979726 ATGCATGCACAAACACACACAGG + Intronic
1075711285 10:124531993-124532015 AGGAAGCCACGAGCCCACACTGG - Intronic
1077223116 11:1426093-1426115 AAGCAAACACCAGCACACACCGG + Intronic
1077801809 11:5546747-5546769 AAGCATTCACAAACACACACGGG + Intronic
1078672254 11:13376106-13376128 ATTCAGGCACTAGCTCACACTGG + Intronic
1079411406 11:20191221-20191243 GAGCAGTCACAAGCCCCCACAGG - Intergenic
1079432240 11:20403535-20403557 ACACAGGCACATGCACACACAGG - Intronic
1082756700 11:57083686-57083708 CAGCAGGCTCAAACCCAAACTGG - Intergenic
1083668233 11:64286536-64286558 CAGCAGGCACCAGGCCAGACAGG - Exonic
1084497139 11:69511795-69511817 AAGCAGACAGAAGCCCTCAAGGG - Intergenic
1084734837 11:71097961-71097983 ACACAGGCACATGCACACACAGG - Intronic
1084734838 11:71097977-71097999 AGGCATGCACATGCACACACAGG - Intronic
1084915203 11:72423773-72423795 AAGCAGGGACCATACCACACTGG - Intronic
1084938459 11:72599888-72599910 GAGCAGGCCCCAGCCCACTCAGG + Intronic
1085283711 11:75346654-75346676 AAGCAGGGACAGACCCACAGAGG - Intronic
1085815795 11:79735759-79735781 ATGCAGACACAGGCCCTCACTGG + Intergenic
1087829748 11:102806949-102806971 CAGCAGGCCCAAACCCCCACTGG - Intergenic
1088445951 11:109928675-109928697 AAGCAGCCTCAGGCCCTCACTGG + Intergenic
1094480151 12:30875099-30875121 AAGCAGGCACCAGGGCCCACAGG - Intergenic
1094582141 12:31743449-31743471 AAGCAGGCACTTCCCCACAGAGG + Intergenic
1095972671 12:47913886-47913908 CAGCAGAAACAAGCCCACAAAGG + Intronic
1096513111 12:52142780-52142802 AAGCAGGAGCAAGCCTGCACTGG - Intergenic
1097013867 12:55971667-55971689 AAGCCTGGTCAAGCCCACACTGG - Exonic
1098090943 12:66900412-66900434 AAGCAGGAAACAGCCCTCACTGG + Intergenic
1100266227 12:92978861-92978883 ATCCAGGCACATGCTCACACTGG - Intergenic
1100792345 12:98144181-98144203 AATCAGCCATAAGCCCACAAAGG + Intergenic
1102217563 12:111172022-111172044 ACGCAGGCACAGGTACACACAGG - Intronic
1102737529 12:115175978-115176000 AAGCACGCACATACGCACACTGG - Intergenic
1103027048 12:117582255-117582277 AAGTAGGCACCAGTGCACACAGG + Intronic
1103058290 12:117838560-117838582 AAGGAGGCACACGCCCAGAGAGG - Intronic
1104424606 12:128665167-128665189 AAACAGGCACACACACACACAGG + Intronic
1104424613 12:128665267-128665289 AAACAGGCACACGCACACACAGG + Intronic
1104433250 12:128733948-128733970 AGGCAGCCACAAGCCCAGAATGG + Intergenic
1106174755 13:27320730-27320752 GAGCAGCCACAAGCCCAACCAGG + Intergenic
1106658479 13:31773229-31773251 AAGATGGCACAAGGTCACACTGG + Intronic
1107150330 13:37104286-37104308 CAGCAGGCCCAAACCCAGACAGG - Exonic
1107552329 13:41488313-41488335 AAGCTGACACATGCCCACAGAGG - Intergenic
1111436661 13:88219775-88219797 AAACAGGCACCAGCCCAAATTGG + Intergenic
1112137511 13:96597939-96597961 AAGCAGACAAAAACCTACACTGG - Intronic
1113466715 13:110518381-110518403 GAGCAGGCACGAGCCAACCCTGG + Intergenic
1119383884 14:74245385-74245407 AGGCAAGCACATGCCCACAGTGG - Intronic
1119529677 14:75351012-75351034 AAGTATGCCCAAACCCACACTGG - Intergenic
1120067113 14:80055676-80055698 AAGCAGGAACAAACAAACACAGG + Intergenic
1123048997 14:105531634-105531656 AAACAGGCTCCAGCCCAGACAGG - Intergenic
1123458511 15:20446766-20446788 AAGCAGGTACAAGCTTCCACAGG - Intergenic
1123659552 15:22553643-22553665 AAGCAGGTACAAGCTTCCACAGG + Intergenic
1123968110 15:25479137-25479159 AAACATGCACAACCCCACAATGG + Intergenic
1124264801 15:28222935-28222957 AAGCAGGTACAAGCTTCCACAGG - Intronic
1124313413 15:28648138-28648160 AAGCAGGTACAAGCTTCCACAGG + Intergenic
1124441149 15:29687432-29687454 AAGGAAGCCCCAGCCCACACTGG - Intergenic
1126286458 15:47018513-47018535 TAGCAGGCTCAAGGCCAAACAGG - Intergenic
1127653182 15:61029356-61029378 AAGCAGGAGCAAATCCACACAGG + Intronic
1131426172 15:92347065-92347087 AAGCACGCACCCACCCACACTGG - Intergenic
1132333262 15:101026959-101026981 GGGCAGGCACAGGCTCACACAGG - Intronic
1133155502 16:3872442-3872464 GAACAGGCAAAAGCCCCCACAGG + Intronic
1134625285 16:15718730-15718752 AAGCAGCCACACCCCCAAACAGG + Intronic
1135165084 16:20131905-20131927 AAGCTGTCACAAGCCCAGTCAGG - Intergenic
1135609967 16:23857671-23857693 AAGCAGGGACAAGCCTAGCCCGG - Intronic
1136028034 16:27482426-27482448 AGGAAGGCACAGGCCCACAGAGG - Intronic
1136702961 16:32160064-32160086 AAGCAGGTACAAGCTTCCACAGG - Intergenic
1136764739 16:32767532-32767554 AAGCAGGTACAAGCTTCCACAGG + Intergenic
1136803360 16:33102852-33102874 AAGCAGGTACAAGCTTCCACAGG - Intergenic
1137443040 16:48512157-48512179 AAGCAGGGACAGGCCCATGCAGG - Intergenic
1138419096 16:56887593-56887615 AAGGTGACACAAGCCCCCACAGG - Intronic
1140298852 16:73736808-73736830 TAGCAGGCACCAACCCAAACAGG + Intergenic
1140627851 16:76816024-76816046 AAGCAAGAACAAAACCACACTGG + Intergenic
1141961212 16:87410704-87410726 AGGGAGGCACAGGCCCACCCGGG + Intronic
1203067095 16_KI270728v1_random:1029657-1029679 AAGCAGGTACAAGCTTCCACAGG + Intergenic
1143752382 17:9037933-9037955 AAGCAGGGGCCAGACCACACAGG - Intronic
1144830017 17:18126080-18126102 AAGTAGGCAGGAGCCCACCCAGG + Intronic
1145903783 17:28505622-28505644 ATGCAGACACACGCCCACCCAGG + Intronic
1146550591 17:33777223-33777245 ATGCAGGCAAAAGCCCAGAGGGG - Intronic
1149492886 17:57097827-57097849 GACCAGGCCCAAGCCCACATTGG + Intronic
1151397853 17:73836385-73836407 AGTCAGGCACAACCCCACTCAGG - Intergenic
1151824670 17:76517593-76517615 AAACAGGCCCAATCCCAAACAGG - Intergenic
1155098111 18:22579703-22579725 GAGCCGACACAGGCCCACACAGG - Intergenic
1155162099 18:23204422-23204444 AAGCAGCAACAAGCACCCACAGG - Intronic
1159359274 18:67380582-67380604 AAGGAAGCACCAGCTCACACAGG - Intergenic
1160678617 19:403515-403537 AGGCACACACAAGCGCACACAGG + Intergenic
1161128777 19:2575725-2575747 ACGCAGGCACACGCACACGCAGG + Intronic
1161128785 19:2575851-2575873 ACGCAGGCACACGCAGACACAGG + Intronic
1162402269 19:10453381-10453403 CTGCACACACAAGCCCACACCGG - Intronic
1163392371 19:17038442-17038464 AAGCAGGCACATGGCCCCCCAGG + Intergenic
1164402768 19:27912966-27912988 TAGGAGGCACAAGACCAAACAGG - Intergenic
1164551988 19:29219562-29219584 AAGGAGGCTCCAGCCCACCCAGG + Intergenic
1165587417 19:36931094-36931116 GAGCAGACACAAGCCCACTGTGG - Intronic
1165736282 19:38178061-38178083 AAGCCTGCACAAGCACACACAGG - Intronic
1166349143 19:42186409-42186431 AAGCATGAACAAGAGCACACAGG + Intronic
1167184005 19:47927845-47927867 AAGCAGGCATGTGCCCCCACAGG + Intergenic
927106923 2:19835836-19835858 AAGCTGGCAGAGGCCCACCCTGG - Intergenic
927539865 2:23899317-23899339 AAAAAGCCACAAGGCCACACTGG + Intronic
927928014 2:27026510-27026532 AAGCAGGCAGAAGCCCGTCCTGG + Exonic
928493337 2:31805765-31805787 ACACAGGCACATGCACACACAGG - Intergenic
931186155 2:59953318-59953340 AAGGAGGCACAAAGCCACAGTGG + Intergenic
931866999 2:66424596-66424618 AAACAGGCACAATACCCCACTGG - Intergenic
933970088 2:87463180-87463202 AAGCAGGACAAAGCCCACAGAGG - Intergenic
934862604 2:97776864-97776886 ATGGAGACACAAGACCACACAGG + Intronic
935078922 2:99772869-99772891 AAGCAGCCACAAACCCTCTCAGG - Intronic
935334866 2:102006874-102006896 AAGCACACACGAGGCCACACTGG - Intronic
937062817 2:118992906-118992928 CTGCAGGCACAAGGCCACAGGGG - Intronic
937248143 2:120506860-120506882 AAGCAGCAACAAGCCCAGAGAGG + Intergenic
937333640 2:121047352-121047374 AAGCCGCCACAGGCCCACTCTGG + Intergenic
937532565 2:122846652-122846674 GAGCAGACACATGCCCACTCTGG - Intergenic
938071493 2:128310728-128310750 TGGCAGGTACACGCCCACACAGG - Intronic
1169003137 20:2182824-2182846 AAGGAGGCCCCAGCTCACACAGG + Intergenic
1170656714 20:18293542-18293564 AAGCAGGAACAAGGCCAAAATGG + Intronic
1170822358 20:19765396-19765418 AGGAAGGCACAAACCCAGACTGG + Intergenic
1170909598 20:20552261-20552283 AAGCAGGCGCAAGTCCACGAAGG - Intronic
1173165641 20:40685275-40685297 AAGCAGGTACAACCCAGCACTGG - Intergenic
1173421599 20:42906231-42906253 ATGCTGGCAGAAGACCACACTGG + Intronic
1176025838 20:62985182-62985204 AGGGAGGCCCAGGCCCACACAGG + Intergenic
1178920303 21:36734337-36734359 AAGCAGGCACAGGCTCAAAAAGG + Intronic
1179316225 21:40246678-40246700 AATCAGGCAGAAGCCCACAGTGG + Intronic
1179480505 21:41673830-41673852 CAGGAGGCACAAGTCCCCACTGG + Intergenic
1180856424 22:19048734-19048756 TAGCATTCACAGGCCCACACGGG - Intronic
1180875676 22:19174224-19174246 AAGCAGGCAGTGGGCCACACTGG - Intergenic
1181877695 22:25952864-25952886 AAACAGGGCCTAGCCCACACTGG - Intronic
1182695845 22:32198899-32198921 AGGCAGACAAAAGCCCAGACGGG - Intronic
1182744711 22:32596684-32596706 AAGCTGGGACATGCCCACGCTGG - Exonic
1183697397 22:39430987-39431009 AGGCAGGCACCAGCTCACCCTGG - Exonic
949815252 3:8051484-8051506 GAGCTGGCAAAAGCCAACACTGG + Intergenic
950152001 3:10694953-10694975 AAGCAGCCACAACATCACACTGG - Intronic
950303045 3:11898575-11898597 AAGCAGGCACAAGCGCACACGGG - Intergenic
950499511 3:13354772-13354794 AAGGAAGCACAAGCCCAGTCAGG + Intronic
950507067 3:13401583-13401605 AAGCAGGCACAAGCCCACACAGG + Intronic
950787640 3:15449648-15449670 AAGCAGGCTCAAGACCACTTGGG + Intronic
951362124 3:21737870-21737892 TATCAGGCACAAACTCACACAGG + Intronic
951373974 3:21889946-21889968 ACACAGGCACACGCACACACAGG - Intronic
953004396 3:38964657-38964679 AAGCAGGTGCAAGGGCACACAGG + Intergenic
954272161 3:49518409-49518431 AAGTAACCAGAAGCCCACACAGG - Intronic
955596944 3:60601200-60601222 AAGCAGGGTGCAGCCCACACTGG - Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
960191416 3:114710860-114710882 AAGTAGGGACCAGCTCACACAGG - Intronic
960479352 3:118170431-118170453 AGGCAGCCACAACCCCACAGAGG - Intergenic
962319215 3:134377006-134377028 AAACAGGCACAGACCCAGACCGG - Intergenic
963834507 3:150043083-150043105 AAGCAGCCTGAAGCCCTCACTGG + Intronic
967560505 3:190912681-190912703 AAGCAGTCACAAGCCTATCCAGG - Intergenic
967907094 3:194510410-194510432 GAGCAGGCAGGAGTCCACACAGG - Intergenic
968648236 4:1750297-1750319 AGGCAGCCCCCAGCCCACACAGG - Intergenic
969472921 4:7400257-7400279 TAGCATGCACAAGCCCTTACAGG - Intronic
969613447 4:8239359-8239381 ACACAGGCACACGCACACACAGG + Intronic
970466574 4:16329614-16329636 AAACAGACACTAGCCCACACAGG - Intergenic
970483220 4:16498706-16498728 AAGCAGCCACAAGCCAGCCCAGG - Intergenic
971356648 4:25901168-25901190 CAGCAGGCAACAGCTCACACTGG - Intronic
972645768 4:40966648-40966670 AAGCACGCACATGCCCATCCAGG - Intronic
973121157 4:46522363-46522385 CAGCTGGCAGAACCCCACACTGG - Intergenic
976078896 4:81332091-81332113 AAGAGGTCACAAGACCACACTGG - Intergenic
977471066 4:97443651-97443673 GGACAGGCACAATCCCACACTGG + Intronic
977721455 4:100244404-100244426 CAGCAGGAACAAACCCATACTGG + Intergenic
979965131 4:127068105-127068127 AAGCAGCCAGAAGCTCAAACTGG - Intergenic
981260777 4:142716110-142716132 CAGCAGACACAAACCCACTCAGG + Intronic
981578336 4:146227961-146227983 AAGAAGGTACAAGCCCAGACAGG + Intronic
982176897 4:152714439-152714461 ATGCAGGAACAACCCCACCCAGG + Intronic
982260177 4:153487958-153487980 AACCAGCCACAGGCCCACAAAGG - Intronic
983642719 4:169958132-169958154 AAGCAGCCTCAAGCCCACCCAGG + Intergenic
985384317 4:189429374-189429396 AATGAGGCACAAGCACAGACGGG + Intergenic
986073455 5:4310841-4310863 AAGCCGGCCCAGGGCCACACAGG - Intergenic
987290747 5:16505867-16505889 AGGAAGGCAGAAGCCCAAACAGG - Intronic
996786044 5:127237658-127237680 CAGCAGGAAGAAGCCCAGACGGG + Intergenic
996976253 5:129438687-129438709 CAGCAGGCATAAGGCCAAACAGG - Intergenic
998038657 5:138937158-138937180 CCGCAGGCACCAGCCCTCACTGG + Intergenic
999161618 5:149505482-149505504 CAGCAGGCCCAAACCCCCACAGG - Exonic
1003087889 6:3076056-3076078 AGGCAGGCAGTAGCTCACACAGG - Intronic
1003246668 6:4387762-4387784 AAGGAGGCTCAAGCCCACTTGGG + Intergenic
1007143293 6:39599548-39599570 TAGCAGGCAAAATCACACACTGG - Intronic
1013286899 6:108689630-108689652 AAGCTGGCACAGGCTCACCCAGG - Intergenic
1013387421 6:109645545-109645567 AAGCAGCCAGAAGCTCAAACTGG + Intronic
1016831008 6:148432981-148433003 AAGCAGGTGAAAGCACACACAGG + Intronic
1018354694 6:163000576-163000598 ATGCATGCCCAAGGCCACACAGG - Intronic
1018907707 6:168085027-168085049 AAGCAGACACATTCCCACAAAGG + Intergenic
1019177689 6:170168690-170168712 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019178144 6:170171159-170171181 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019178191 6:170171439-170171461 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019178241 6:170171739-170171761 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019356560 7:582959-582981 AACCAGACACAAAGCCACACAGG + Intronic
1019560481 7:1653709-1653731 ATGCAGGCACATGCACACAAGGG + Intergenic
1019603556 7:1897400-1897422 AAGCAGCCACATGCCAAGACGGG + Intronic
1020116401 7:5478760-5478782 ACGCAGGCACATGTACACACAGG + Intronic
1022044642 7:26613150-26613172 ACACAGACACAAGCACACACAGG - Intergenic
1022453599 7:30537958-30537980 AAGCAGCCAGAAGCTCAAACTGG + Intronic
1030251461 7:107450051-107450073 AACTAGGCACAAGCCCAGAGAGG - Intronic
1031259565 7:119501141-119501163 AAGCAGGCACTACCACACCCAGG - Intergenic
1034395711 7:150823409-150823431 AAGAAGTCACAAGCGCACACGGG + Intergenic
1034963630 7:155377968-155377990 AAGCCGGCTCAAGCCCGCACAGG - Intergenic
1036018334 8:4812297-4812319 AAGCAGCCACTATCCCAAACTGG - Intronic
1039226685 8:35396347-35396369 AAGCAGGCACAAGCAGTCAAGGG + Intronic
1039578720 8:38646506-38646528 AAGCAGGCCCAAGACTGCACAGG - Intergenic
1040486934 8:47882400-47882422 ATGCATGCACAAGCACACACAGG + Intronic
1040806675 8:51404057-51404079 AAGAATGAACAAGCCCAGACAGG - Intronic
1040865681 8:52046984-52047006 AAGCAGCCAGAAGCTCAAACTGG - Intergenic
1042751524 8:72162916-72162938 AACCAGGTACAAGCTCACCCTGG + Intergenic
1045031216 8:98138272-98138294 AAGAAGGCACAAGATTACACGGG - Intronic
1046638279 8:116697177-116697199 AAAAAGGGACAAGCACACACAGG - Intronic
1047974201 8:130113127-130113149 AAGCAGTCAGAAGCCCACAGAGG - Intronic
1048058643 8:130894261-130894283 TAGCAGGCACAACCCCAAAGAGG - Intronic
1048550891 8:135432879-135432901 AAGCAGGCCAAAGGCCACAGTGG + Intergenic
1049410186 8:142470540-142470562 AAGCAGGGACACACACACACAGG - Intronic
1054740200 9:68798648-68798670 AGGCAGGCAACAGACCACACGGG + Intronic
1056084485 9:83132110-83132132 AAGTGGTCACAAGCCCACCCAGG - Intergenic
1056423467 9:86453125-86453147 AACCAGGAACAAGCCCCGACCGG - Intergenic
1057439384 9:95071985-95072007 AAGCTGGCCCAAACCCACTCGGG + Intronic
1057840996 9:98485500-98485522 ACGCAGGCACACACACACACAGG + Intronic
1061247112 9:129406178-129406200 AAGAGGGCCCCAGCCCACACCGG - Intergenic
1061841599 9:133361662-133361684 AATCAGGCCCTAGCCCACCCAGG + Exonic
1062309770 9:135929458-135929480 ATGCAGGCACCACCCCACAGGGG + Intergenic
1185558311 X:1038754-1038776 AAGCAGACAGCAGCCCTCACCGG - Intergenic
1186538963 X:10380468-10380490 GAGTAGGCACAAACCCAGACTGG + Intergenic
1186607547 X:11107813-11107835 AAGCAGTCAGAAGCAGACACTGG - Intergenic
1186642768 X:11473490-11473512 ATACAGACACAAGCACACACAGG + Intronic
1186837687 X:13453731-13453753 AATCAGGCAGAAGCACACATTGG - Intergenic
1188268824 X:28113439-28113461 AAGCAGATAAAAGCCCAGACTGG + Intergenic
1189161015 X:38808578-38808600 CAGCAGGCCCAAACCCCCACAGG - Intergenic
1190015230 X:46820563-46820585 AAGCCGGCACAACACAACACTGG - Intergenic
1190251553 X:48730883-48730905 AGACAGTCCCAAGCCCACACTGG + Intergenic
1190417533 X:50195593-50195615 ATGCAGTGACATGCCCACACAGG - Intronic
1191016267 X:55813436-55813458 GAGCAGGCACAAGCCTGCAGGGG - Intergenic
1191128496 X:56983464-56983486 AAACAGTCACAATCTCACACAGG + Intronic
1197386829 X:125812672-125812694 AGGCAGGCAGCATCCCACACAGG - Intergenic
1197639921 X:128956185-128956207 AAGAGGGCACAAGCCCCAACAGG + Intergenic
1198127707 X:133662575-133662597 AAGTTGGCAAAACCCCACACTGG - Intronic
1198580727 X:138061415-138061437 AAGCAAGCTCAAGACCACAGGGG - Intergenic
1199502438 X:148522280-148522302 ATGCATGCACAAGCCCCCTCTGG - Intronic
1200278647 X:154757899-154757921 AAGCAGCCACAAGCCTGCTCAGG - Intergenic
1200692237 Y:6318062-6318084 AAGCAGGCACAATCCACCCCTGG - Intergenic
1201043035 Y:9856665-9856687 AAGCAGGCACAATCCACCCCTGG + Intergenic
1202162784 Y:21952924-21952946 AAGCAGGCACAATCCACCCCTGG - Intergenic
1202228572 Y:22633444-22633466 AAGCAGGCACAATCCACCCCTGG + Intergenic
1202314585 Y:23562723-23562745 AAGCAGGCACAATCCACCCCTGG - Intergenic
1202556217 Y:26107872-26107894 AAGCAGGCACAATCCACCCCTGG + Intergenic