ID: 950507292

View in Genome Browser
Species Human (GRCh38)
Location 3:13403330-13403352
Sequence GACAACAGTGGGAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 274}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950507292_950507300 -2 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507300 3:13403351-13403373 TCACATGGCAGAAGGGGCGAGGG 0: 2
1: 48
2: 186
3: 531
4: 1981
950507292_950507304 24 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507304 3:13403377-13403399 TCTCTGGGGCCTTTTGTATAAGG 0: 1
1: 14
2: 159
3: 537
4: 1229
950507292_950507302 9 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507302 3:13403362-13403384 AAGGGGCGAGGGAGCTCTCTGGG 0: 10
1: 72
2: 240
3: 587
4: 1001
950507292_950507297 -9 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507297 3:13403344-13403366 ACTGTTGTCACATGGCAGAAGGG 0: 1
1: 0
2: 10
3: 102
4: 568
950507292_950507303 10 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507303 3:13403363-13403385 AGGGGCGAGGGAGCTCTCTGGGG 0: 11
1: 66
2: 211
3: 570
4: 1030
950507292_950507299 -3 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507299 3:13403350-13403372 GTCACATGGCAGAAGGGGCGAGG 0: 1
1: 4
2: 67
3: 258
4: 902
950507292_950507301 8 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507301 3:13403361-13403383 GAAGGGGCGAGGGAGCTCTCTGG 0: 11
1: 81
2: 240
3: 553
4: 933
950507292_950507305 25 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507305 3:13403378-13403400 CTCTGGGGCCTTTTGTATAAGGG 0: 1
1: 11
2: 136
3: 507
4: 1135
950507292_950507298 -8 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507298 3:13403345-13403367 CTGTTGTCACATGGCAGAAGGGG 0: 1
1: 5
2: 37
3: 210
4: 757
950507292_950507296 -10 Left 950507292 3:13403330-13403352 CCTGCTGTCTTCCCACTGTTGTC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 950507296 3:13403343-13403365 CACTGTTGTCACATGGCAGAAGG 0: 1
1: 1
2: 12
3: 97
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950507292 Original CRISPR GACAACAGTGGGAAGACAGC AGG (reversed) Intronic
900345777 1:2209644-2209666 GCCAACAGGGGGAGGGCAGCAGG + Intronic
901256045 1:7827516-7827538 GACAACAGAGGACAGACAGGGGG - Exonic
901744026 1:11360780-11360802 GACAACACTGGGAAGAGAGAAGG + Intergenic
902691967 1:18115617-18115639 GACCACAGTGGCATCACAGCTGG + Intronic
902768961 1:18634665-18634687 GAAAACAATGGGAGGACATCTGG - Intronic
903103130 1:21050970-21050992 AACACAAGTGGCAAGACAGCCGG - Exonic
903927189 1:26838992-26839014 GACAACAGTGGAAGGGCAGAGGG + Intronic
905069286 1:35211069-35211091 GGCAACAGTGGGAAGGCATTTGG - Intergenic
905890398 1:41515305-41515327 GACAAAAGTGGGCATTCAGCCGG + Intronic
906237958 1:44223163-44223185 CAGAACAGTGGAAAGACAGATGG + Intronic
906562435 1:46768989-46769011 GACAAGGGTCGGAAGACAGAGGG - Intronic
907416833 1:54320252-54320274 GACCACAGAGGGAAGACATCTGG + Intronic
907442355 1:54487004-54487026 GAAACCAGTGAGAAGAGAGCTGG - Intergenic
908346314 1:63237147-63237169 GACAAGTGGGGGAAGTCAGCAGG + Intergenic
909893117 1:81032799-81032821 GACCAGAGAGGGAAGACAGTTGG + Intergenic
910037708 1:82807955-82807977 GAGAAAAGTGGCAAGGCAGCTGG - Intergenic
912821655 1:112872581-112872603 GAGAACAGTGGGAGAACAGTGGG - Intergenic
913173111 1:116249978-116250000 GGACACAGTGAGAAGACAGCTGG + Intergenic
914864206 1:151412677-151412699 GGAAACAGTGGTAAGACAGGAGG - Intronic
915275262 1:154784063-154784085 GAGACCAGTGGAAAGACACCGGG + Intronic
916115162 1:161479852-161479874 GCCAGCAGTGGGCAGCCAGCAGG + Intergenic
917527469 1:175801778-175801800 GACAACCGTGTGAAGACACAGGG - Intergenic
917648725 1:177054687-177054709 AACAGCAGTGGGAACAAAGCTGG + Intronic
919172848 1:193977627-193977649 AATAACAGTTGGAAGACAGGAGG - Intergenic
919663302 1:200269055-200269077 GACCAAAGTGGGAGGATAGCAGG - Intergenic
924083065 1:240419860-240419882 GGCAAGAGTGGGAAAACAGGAGG - Intronic
1063092787 10:2882477-2882499 GACAACATTAGGAAGACCTCGGG + Intergenic
1064346866 10:14540534-14540556 GAGAACAGGGGGAGGACAGAGGG - Intronic
1065015246 10:21456832-21456854 GAAGACAGTGTGAAGACACCAGG - Intergenic
1065916627 10:30358650-30358672 GAGAAAAGTGGGCAGAGAGCTGG - Intronic
1066245195 10:33576150-33576172 CACAAGGGTGGGAACACAGCAGG + Intergenic
1067162692 10:43840879-43840901 GACAGAAATGGGAAGAAAGCAGG - Intergenic
1067650094 10:48146803-48146825 GACCACATGGGGAAGACACCAGG + Intergenic
1069325570 10:67227853-67227875 GACCACAGTGGGAAAAAAACTGG + Intronic
1070023617 10:72610518-72610540 AGAAACAGTGGGAAGACAGTAGG + Intronic
1070029039 10:72659208-72659230 AACAACAGAAGGAAAACAGCAGG - Intergenic
1070127605 10:73634691-73634713 TCCAACAGTGGGGGGACAGCTGG - Exonic
1071787981 10:88924391-88924413 GAAGACATTGGGAAGACAGAAGG - Intronic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1076045089 10:127286031-127286053 GAGCCCAGTGGGAAGCCAGCTGG - Intronic
1076644659 10:131944662-131944684 GACAGCAGAGGGAGGACGGCAGG - Intronic
1077505895 11:2929810-2929832 GCCCACCGTGGGGAGACAGCCGG + Intergenic
1077998251 11:7472324-7472346 GACACAAGTGGGAAGACACCAGG - Intergenic
1080777460 11:35399208-35399230 GACTAAATTGGGAGGACAGCAGG - Intronic
1082082969 11:48026425-48026447 GGCCACAGCAGGAAGACAGCAGG - Intronic
1083808820 11:65090864-65090886 TTCAACAGTGGGACCACAGCTGG - Intronic
1084302935 11:68263070-68263092 GCCAACAGTGGGAAGAGAGATGG - Intronic
1084780122 11:71402543-71402565 GGGGACAGTGGGGAGACAGCAGG + Intergenic
1085685619 11:78619645-78619667 GACAAAAGTGGAAAGACTGATGG - Intergenic
1086451757 11:86924150-86924172 GACAAGGCTGGGAGGACAGCAGG + Intronic
1087915119 11:103800874-103800896 GACAACAGGGGGGCGCCAGCTGG + Intergenic
1088314817 11:108497468-108497490 GACAACAGCGTGAAACCAGCAGG + Intronic
1089039891 11:115437322-115437344 GAGAAAACGGGGAAGACAGCTGG + Intronic
1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG + Intronic
1090113657 11:123943161-123943183 GAGAACAGTGGCAAGAATGCAGG + Exonic
1090153419 11:124409917-124409939 GAACACAGGGGAAAGACAGCAGG + Intergenic
1090399779 11:126441583-126441605 GATACCAGAGGAAAGACAGCCGG + Intronic
1091181562 11:133609090-133609112 TAGAACAGTGGAAAGACACCAGG - Intergenic
1091457252 12:617295-617317 GACAACAGAGGAAAGACACTGGG + Intronic
1091626381 12:2124067-2124089 GAGACCAGAGGGAGGACAGCAGG - Intronic
1092035787 12:5333304-5333326 GAGCACATTGGGAAGACATCAGG + Intergenic
1092066979 12:5598771-5598793 GCCAACAGTGCAAAGGCAGCTGG + Intronic
1092111071 12:5965249-5965271 GACAACTGTGTGAGGAAAGCAGG - Intronic
1093771980 12:23028868-23028890 GATAACACTTGGAAGACAGGTGG + Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1095556423 12:43511220-43511242 GACAAGAGATTGAAGACAGCGGG - Intronic
1095995608 12:48081147-48081169 GACAACAGCAGCATGACAGCTGG - Intronic
1097271108 12:57774779-57774801 GTGAACAGTGTGAACACAGCAGG + Intronic
1101293360 12:103394844-103394866 GAGAACAAGGGGAAGACAGGTGG + Intronic
1102180483 12:110909040-110909062 GACAACAGTGGGAGGAGCTCAGG - Intergenic
1102302593 12:111781524-111781546 GGCTACAGTGTGAGGACAGCTGG - Intronic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1106632442 13:31489830-31489852 GACAATAGTGCAAAGACAGAAGG - Intergenic
1108709041 13:53015512-53015534 GATAACATTGGGAAGATAGGAGG - Intergenic
1109092989 13:58072220-58072242 GACTACAGTAGGAAGTCAGAAGG - Intergenic
1109803856 13:67411158-67411180 GACAAAAGTGAGATGACAGATGG + Intergenic
1113281104 13:108788844-108788866 GAAAACTGTGGGAAGATGGCAGG - Intronic
1113972748 13:114202529-114202551 GGAAGCAGTGGGGAGACAGCAGG - Intergenic
1114487064 14:23069151-23069173 GAGAAGCTTGGGAAGACAGCAGG + Intronic
1117959929 14:61152899-61152921 GTAGACAGTGGGGAGACAGCTGG + Intergenic
1118253955 14:64188859-64188881 GAGAACAGTTGGAAGAGAGGAGG + Intronic
1119414925 14:74463497-74463519 GACGACAGTGGGAAGAGGGCAGG - Intergenic
1121134675 14:91486126-91486148 GACAATAGAGGGAAGAGAGAAGG - Intronic
1121875000 14:97442950-97442972 GATAACTGTGGGAAGACACAAGG - Intergenic
1125437600 15:39664094-39664116 GACAGCACTGGCAAGAAAGCAGG + Intronic
1126044983 15:44630979-44631001 TACATCAGTGGAAAAACAGCAGG + Intronic
1127019287 15:54727685-54727707 GACAAGAGTTGGAAGAGAGGTGG + Intergenic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1128249168 15:66152725-66152747 GGCCACAGTGGGAGGACAGCAGG - Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1131780947 15:95858082-95858104 GAGGAAAGTGGGTAGACAGCTGG + Intergenic
1133203246 16:4217551-4217573 GGCGCCAGTGGTAAGACAGCAGG - Intronic
1135152941 16:20025722-20025744 GTCCACAGTGGGAAGACCCCAGG - Intergenic
1135563710 16:23495884-23495906 CAGACCAGTGGGCAGACAGCTGG + Intronic
1140219592 16:73033880-73033902 GTCAACAGTGAGAAGACTCCAGG + Intronic
1141363993 16:83425413-83425435 GCCAAGAGTGGGAACGCAGCAGG - Intronic
1142908044 17:3061651-3061673 GACTACAGTGGGAAGAATGGTGG - Intergenic
1142926521 17:3242615-3242637 GACTACAGTGGGAAGAATGGTGG + Intergenic
1142975150 17:3638994-3639016 GCCAACAGAGGTCAGACAGCTGG + Intronic
1143011668 17:3869474-3869496 GACCACGGTGGTAAGAGAGCCGG - Exonic
1143794233 17:9323724-9323746 GACAACACTGTGAAGAGAGGAGG + Intronic
1143961256 17:10722614-10722636 GACAACAGTGGCATAAAAGCTGG - Intronic
1144945165 17:18966045-18966067 GTCAAAAGTGGCAAGTCAGCAGG + Intronic
1146217352 17:30988207-30988229 CACCACAGTGGTAATACAGCTGG - Intronic
1146229716 17:31096250-31096272 GACAACAGAGCAAAGCCAGCTGG + Intronic
1147013058 17:37467248-37467270 GACAGCAGCTGGAAGATAGCTGG + Intronic
1148683754 17:49489198-49489220 GTCAACAATGGGAAGATAGGAGG - Intergenic
1148791778 17:50177213-50177235 GACCGCAGTGGGACCACAGCGGG - Intergenic
1149690046 17:58567910-58567932 AACTATAGAGGGAAGACAGCAGG + Intronic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1151946857 17:77324314-77324336 GACAACAGGGGGATGAAAGGTGG - Intronic
1152248498 17:79199087-79199109 GAAAACAGTGGGAAGCAAGTGGG + Intronic
1154459852 18:14571343-14571365 TACAACATTGGGAACACAGAAGG - Intergenic
1155413005 18:25566598-25566620 CACAACTGTGGGAACACAGAGGG - Intergenic
1157579686 18:48766308-48766330 GACCACAGTGGGAAGTCACAAGG + Intronic
1158396571 18:57083289-57083311 GCCAGCAGTAAGAAGACAGCAGG - Intergenic
1159174408 18:64814749-64814771 GACTACAGGGGGAAAACAGCTGG + Intergenic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1160390725 18:78529720-78529742 GAGAACAGTGGCTATACAGCTGG + Intergenic
1162057904 19:8075876-8075898 GACAATAGTGTGAGGTCAGCCGG + Intronic
1167501987 19:49853752-49853774 GGAAACATTTGGAAGACAGCTGG - Intronic
925460386 2:4057919-4057941 GACAAAAGTGGGAAGGCTGATGG - Intergenic
925635624 2:5938676-5938698 GCCGAGAGTGGGAATACAGCAGG - Intergenic
929916693 2:46142524-46142546 GGCCTCAGTGGCAAGACAGCAGG + Intronic
930670388 2:54143914-54143936 GTCAACATTGAGAAGGCAGCAGG - Intronic
930923972 2:56793177-56793199 GACAAATGTGGGGATACAGCTGG + Intergenic
930973759 2:57429283-57429305 GACAACTGAAGGAAGACAGTCGG - Intergenic
933983624 2:87573262-87573284 AACAGCAGTGGGGAGAGAGCGGG - Intergenic
934542703 2:95189213-95189235 GACAGAGCTGGGAAGACAGCTGG - Intergenic
934859893 2:97755709-97755731 GGGCACAGAGGGAAGACAGCAGG - Intergenic
934859898 2:97755731-97755753 GGGCACAGAGGGAAGACAGCAGG - Intergenic
935791458 2:106594821-106594843 GAAAACAGTGAGAAAACATCAGG - Intergenic
936310227 2:111377532-111377554 AACAGCAGTGGGGAGAGAGCGGG + Intergenic
937216555 2:120316941-120316963 AAGAACAGGGAGAAGACAGCTGG - Intergenic
937913973 2:127089949-127089971 GACTAGGGTGGGAAGACTGCAGG - Intronic
937917210 2:127105230-127105252 GACACCAGTGGGAAGGGGGCAGG + Intronic
938115748 2:128602064-128602086 GAGATCAGTGGGCAGAAAGCCGG + Intergenic
938664894 2:133524612-133524634 GAGAGCAGTGGGAAGAAAGGAGG - Intronic
939393186 2:141594319-141594341 CACAACACTGGGAAGGCAGATGG + Intronic
939887845 2:147700719-147700741 GACAAAAGAGGGAAGAAGGCCGG + Intergenic
940747520 2:157585246-157585268 ATGAACAGTGGGAGGACAGCAGG - Intronic
941696155 2:168553104-168553126 GACAAAATTGGGAAGAAGGCAGG + Intronic
941764629 2:169283635-169283657 GACATCAGAGGAAAGACAGCTGG - Intronic
943960552 2:194257216-194257238 GAAAACACTGGGAAGAGAGAAGG + Intergenic
944223752 2:197328473-197328495 CAGAACAGTGGCAAGACAACGGG - Intergenic
944333530 2:198501654-198501676 GAAAACAGTGGGAAGAAAATAGG - Intronic
945796156 2:214366714-214366736 GAAAACAATTGGAACACAGCAGG + Intronic
946253727 2:218429095-218429117 GAAACCAGGGGGAAGGCAGCTGG - Intronic
947171079 2:227312202-227312224 GACAAATGTGGGAATCCAGCGGG - Exonic
949057618 2:241936993-241937015 GACAACAGGCGGCAGACAGTAGG + Intergenic
1169143098 20:3237091-3237113 GACATGAGGAGGAAGACAGCTGG + Intronic
1169152902 20:3304496-3304518 GACGACAGTGAGAAAACAGAAGG + Exonic
1169622609 20:7524895-7524917 CACCCCAGTGGGAAGACAGAGGG - Intergenic
1170153955 20:13252856-13252878 GAGAGAAGTGGGAAGACAGAAGG - Intronic
1170584600 20:17724996-17725018 GACAGCAGTGGGGAGAGAGGAGG - Intronic
1170794413 20:19533855-19533877 GACAGCTGGGGGAAGGCAGCTGG - Intronic
1171517046 20:25746258-25746280 GAGAATTGGGGGAAGACAGCTGG + Intergenic
1171810228 20:29741240-29741262 GAAAACAGAGGGAAGAGAGCCGG - Intergenic
1173658018 20:44714514-44714536 GAAAACAGAGGGAAAACAGGTGG - Intergenic
1175778727 20:61668959-61668981 GACAACCCTGGGAAGCCAGTGGG + Intronic
1176013611 20:62915105-62915127 GACCACAGAGGGAAGGCAGTTGG - Intronic
1176814263 21:13581483-13581505 TACAACATTGGGAACACAGAAGG + Intergenic
1178890245 21:36514898-36514920 GATAACAGTGGGAAGACCCGGGG - Intronic
1179563037 21:42228805-42228827 GACAACAGTGGGCACAGAGAGGG - Intronic
1180059419 21:45376873-45376895 GACATCAGTGGAATGAGAGCGGG + Intergenic
1183452457 22:37904600-37904622 GATAACAGTGGCAGGAAAGCAGG - Intergenic
1184572800 22:45337182-45337204 GACAAAACGGGGAAGCCAGCGGG - Intronic
1184806338 22:46796970-46796992 GGCAACAGTGGGGACACAGCAGG - Intronic
949393052 3:3584278-3584300 CAACACAGTGGGAACACAGCAGG + Intergenic
950030261 3:9847332-9847354 GACCACAGTGGGAAGATGGCAGG + Intronic
950094015 3:10317697-10317719 GACAGCAGGAGGAAGACAGGTGG + Intronic
950261018 3:11543546-11543568 TACAAGAGTGGGAAGGCAGGCGG + Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
950549823 3:13659386-13659408 GACAAAAATGGGAAGGCAGGTGG + Intergenic
953924598 3:46976173-46976195 GACAGCAGTGGGTATACAGCCGG - Intronic
954402092 3:50324267-50324289 GACCACAGTGGGCAGGCTGCAGG + Intronic
956749492 3:72334922-72334944 GAAGACAGTGAGAAGACACCAGG + Intergenic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
959505318 3:107150746-107150768 TGCAGCAGTGGGAAGACAGCAGG + Intergenic
960308810 3:116095548-116095570 GACAACAATAGGAATACAGATGG - Intronic
960986195 3:123282612-123282634 AACAACAGCTGGAAGAAAGCAGG + Exonic
961091460 3:124116126-124116148 GCCACCAGAGGGAAGAGAGCTGG - Intronic
961493560 3:127274366-127274388 GACAGCAGAGAGAAGCCAGCAGG - Intergenic
962160674 3:132996472-132996494 GACACCAGCATGAAGACAGCAGG - Intergenic
962829946 3:139131139-139131161 GACAAGAGTGGGAAAAGAGTAGG + Intronic
962952911 3:140235912-140235934 AACAGCAGTGGGAATAAAGCTGG + Intronic
963258453 3:143169671-143169693 GAGACCAGTGAGAAGACAGTGGG - Intergenic
964264734 3:154881539-154881561 AACAACAGTGTCAAAACAGCTGG + Intergenic
964423688 3:156530842-156530864 GAATACAGTGGAAAGACAGGAGG + Intronic
966170659 3:177076346-177076368 GAGAACAGTGTGAAGACACAGGG - Intronic
967338100 3:188366859-188366881 CAAAACAGTGAGAAGACATCAGG - Intronic
967988636 3:195114908-195114930 GCCAAGTGTGGGAAGACACCGGG + Intronic
969322711 4:6422632-6422654 GACAACTGTGTGAAGACACAGGG - Intronic
969593026 4:8132665-8132687 GTCACCCGAGGGAAGACAGCGGG - Intronic
969656162 4:8499711-8499733 GAGAACAGTGGGCAGAAAGAGGG + Intergenic
970010896 4:11457947-11457969 GAAAACTGTGTGAAGACAGAGGG - Intergenic
971979515 4:33734600-33734622 GACAGCAGAGGCAAGGCAGCAGG - Intergenic
974036365 4:56821675-56821697 GACCGCAGGGGCAAGACAGCCGG - Exonic
975379264 4:73679335-73679357 AAAAAGAGTGGGAAGACAGCAGG + Intergenic
977150916 4:93510241-93510263 GACAAGAGTGGCCTGACAGCTGG - Intronic
978019173 4:103786878-103786900 AACCACAGAGGGAAAACAGCAGG + Intergenic
978649244 4:110980647-110980669 GAAAAAAGTGGGAAGAAATCAGG - Intergenic
978905135 4:113996633-113996655 GACAACTGTGGGTAGAAACCAGG + Intergenic
979641228 4:123014101-123014123 AAAAACAGAGGGAAGACAGAGGG - Intronic
981875121 4:149532941-149532963 GAGGTCAGTGGGAAGACAGCAGG + Intergenic
982240807 4:153297586-153297608 GAGATCAGTGGGGAGCCAGCAGG - Intronic
982453484 4:155579434-155579456 CACAGCACTGGGAACACAGCAGG + Intergenic
984088342 4:175339826-175339848 GACAAAATAGGGAAGACTGCAGG - Intergenic
984906670 4:184634013-184634035 GATTACACTGGGAAGATAGCAGG - Intronic
987213320 5:15706988-15707010 GACAGCAGTGGAGAGTCAGCTGG + Intronic
988335369 5:29900978-29901000 GATAAGAGAGGGAAGAAAGCTGG - Intergenic
988502846 5:31798113-31798135 GACACCAGTCAGCAGACAGCAGG - Intronic
988677066 5:33443126-33443148 TACAACACTGGGAAGAGAGTAGG - Intronic
989303951 5:39929774-39929796 GACCACAGTGGGAAAACCTCTGG + Intergenic
989714820 5:44450691-44450713 GACAACTGTGGGGAGACATTGGG - Intergenic
990107852 5:52286708-52286730 GACAACACTGGGCATAGAGCTGG + Intergenic
992389378 5:76316297-76316319 GACATCCCTGGGAAGACAGCAGG + Intronic
992762686 5:79965017-79965039 GACAACAGTGGGAAGAGACAGGG - Intergenic
994821231 5:104653104-104653126 GACAGCAGTGTTAAGGCAGCTGG - Intergenic
996342950 5:122458219-122458241 ACCAACAGTAGGAAGACAACAGG + Intronic
997597120 5:135114487-135114509 GACAACAGAGGGAAGGCTCCAGG + Intronic
997829394 5:137136736-137136758 AAGAGCAGTGTGAAGACAGCTGG - Intronic
997978649 5:138455140-138455162 GCAAACAGTGGGGAGCCAGCTGG - Intergenic
998056767 5:139085266-139085288 GACCACAGTGGAAAGAAAGGGGG + Intronic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
999818094 5:155197941-155197963 GACCACAATGGAAAGACATCAGG - Intergenic
1000896866 5:166865814-166865836 GAGAAAAGTGGGAAGAGAGATGG + Intergenic
1001131761 5:169070028-169070050 GACAGCAGTGGGAAGAGAAAAGG + Intronic
1001851617 5:174972522-174972544 CAGAACAGTGGGAAGACAAGTGG - Intergenic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1005565083 6:27083581-27083603 GACCACAGTGAGGAGACTGCTGG - Intergenic
1005810633 6:29512794-29512816 GACAACTGTGTGAAGACACAGGG + Intergenic
1006547666 6:34792692-34792714 GAAAGCAGAGAGAAGACAGCTGG - Intronic
1007789263 6:44299795-44299817 GGCAACAGTGGGCAGACAAAGGG - Exonic
1007876742 6:45111766-45111788 GACTACAGTGAGATGTCAGCTGG - Intronic
1007967174 6:46014080-46014102 GGCCACAGTGGGAAGAGAACAGG + Intronic
1009947653 6:70358342-70358364 GAACACAGTGAGAAGGCAGCTGG + Intergenic
1010628304 6:78166566-78166588 GATTACAGGGAGAAGACAGCTGG - Intergenic
1013429268 6:110041285-110041307 GAGATCACTGTGAAGACAGCTGG - Intergenic
1013753212 6:113431168-113431190 GACAATAAAGGAAAGACAGCAGG + Intergenic
1015571325 6:134624270-134624292 GACACCAGTCACAAGACAGCAGG - Intergenic
1015671397 6:135693993-135694015 GGAAACAGCGGGAAGACAGATGG - Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016041986 6:139441158-139441180 CACAATAGTGGGAGGAAAGCAGG + Intergenic
1016371507 6:143379361-143379383 GACATCGGTGGGGAGACAGAAGG + Intergenic
1016498278 6:144689441-144689463 GACAAAAGAATGAAGACAGCAGG - Intronic
1016893683 6:149032331-149032353 GGGAAGACTGGGAAGACAGCAGG - Intronic
1020409384 7:7874289-7874311 GAAAGAAGTGGGAAGATAGCTGG - Intronic
1022134722 7:27436478-27436500 GACTCCAGTGGGAAGACATTTGG + Intergenic
1023547518 7:41334220-41334242 GAAAACAGAATGAAGACAGCTGG - Intergenic
1024087109 7:45902735-45902757 GAGAACTGAGGGATGACAGCTGG + Intergenic
1024278501 7:47698437-47698459 CAGAAGAGTGGGAAGACAGAAGG + Intronic
1026821893 7:73555608-73555630 GACTTCATTGGTAAGACAGCGGG + Intronic
1027528276 7:79298843-79298865 GAAAACTGTGTGAAGACAGAGGG + Intronic
1030745059 7:113155213-113155235 CATACCAGTGAGAAGACAGCAGG - Intergenic
1031106739 7:117553053-117553075 GAACACAGCAGGAAGACAGCTGG + Intronic
1032061445 7:128728549-128728571 GTCAAAACTGAGAAGACAGCAGG + Intronic
1032440302 7:131937630-131937652 TACCACAGTGGGGAGACAGCAGG + Intergenic
1034394776 7:150813847-150813869 GACGACAGGGGGAATAAAGCTGG + Intergenic
1034759689 7:153659553-153659575 GACTACAGTGAAAAGGCAGCAGG - Intergenic
1034864131 7:154626069-154626091 GACAAGCTTGGGAAGAAAGCAGG + Intronic
1034948250 7:155278229-155278251 AACAGCAGTGGGAAGAAGGCTGG - Intergenic
1035053258 7:156016671-156016693 GACATCAGTGGGAAAACACATGG + Intergenic
1037436362 8:18867801-18867823 GACATCAGGGGGAGGACATCAGG - Exonic
1039553650 8:38461151-38461173 TACTCCAGTGAGAAGACAGCAGG - Exonic
1039983463 8:42428480-42428502 GGAAACAGTGGGAGGATAGCAGG + Intronic
1040530882 8:48265502-48265524 GACAACAGGAGGAGGAGAGCTGG + Intergenic
1042747334 8:72121696-72121718 TACAAGAGTGGAAAGACTGCAGG - Intergenic
1043821194 8:84867141-84867163 GAAAACAGTGTGAAGACATGGGG - Intronic
1044949075 8:97418152-97418174 GCCAAGAGTGGGAAGAAAACTGG - Intergenic
1046296695 8:112229136-112229158 TACAATAGTGGGAAGACATATGG + Intronic
1046627214 8:116587854-116587876 GACAACCATGTGAAGACAGAGGG - Intergenic
1047051844 8:121121600-121121622 TACAACAAAGGAAAGACAGCAGG + Intergenic
1047327733 8:123855592-123855614 GGGTCCAGTGGGAAGACAGCCGG - Intronic
1048353238 8:133632817-133632839 GACTATCGTGGAAAGACAGCAGG + Intergenic
1049399858 8:142420207-142420229 GACACCAGTGGGGAGAAAGGAGG - Intergenic
1051356487 9:16243957-16243979 AACAAAGGTGGGAAGACAGTGGG - Intronic
1052000935 9:23279427-23279449 GACAATACTGGGCAGACAGAGGG + Intergenic
1052215702 9:25963673-25963695 AACCACAGAGGGAAAACAGCAGG - Intergenic
1054809665 9:69425054-69425076 GATGACGGTGGGAAGACAGCTGG - Intergenic
1055582117 9:77716918-77716940 GTGATCATTGGGAAGACAGCAGG + Exonic
1055935764 9:81603072-81603094 GACAACAGCGTGAAGTCACCGGG + Intronic
1057015231 9:91645198-91645220 GAAAACACTGGGAAGCCATCCGG + Intronic
1057091415 9:92261432-92261454 GATGACAGTGGGAAGGCAGGAGG + Intronic
1058009725 9:99963604-99963626 GACAAAAGTGGGAATGCAGTTGG - Intronic
1060540836 9:124429082-124429104 GACAGCAGTCGGGAGACAGGTGG + Intergenic
1061100134 9:128485841-128485863 GACAACAGAGAGAAGACACTCGG - Intronic
1062295853 9:135826143-135826165 GACAACAGGGTGCAGACAGCAGG + Intronic
1186322749 X:8448068-8448090 TGCACCAGTGGGAAGACAGGAGG + Intergenic
1188416244 X:29938506-29938528 GAGAAGTGTGGGAAGAAAGCTGG - Intronic
1189316890 X:40062843-40062865 GACAACAGCGAGAAGCCATCCGG - Exonic
1191630430 X:63315773-63315795 GACAACAGTGGAAAGGCTGATGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1192820471 X:74639460-74639482 GACCACAGTGGGAATAAAACTGG + Intergenic
1193200868 X:78688935-78688957 GATAAGAGAGGGAAGAGAGCGGG + Intergenic
1193604853 X:83553819-83553841 TACTAGAGTGGGAAGAAAGCAGG + Intergenic
1196777917 X:119357709-119357731 GACAAAAATGGAAAGATAGCTGG + Intergenic
1197356092 X:125438702-125438724 AACCACAGAGGGAAAACAGCAGG - Intergenic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1197867255 X:131032493-131032515 GAGATCAGTAGGCAGACAGCTGG - Intergenic
1200791045 Y:7299248-7299270 AGAAACAGAGGGAAGACAGCAGG - Intergenic