ID: 950507842

View in Genome Browser
Species Human (GRCh38)
Location 3:13406769-13406791
Sequence CTTCTCTGCACCTCAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950507838_950507842 -6 Left 950507838 3:13406752-13406774 CCTGCACACCTGTCCTTCTTCTC 0: 1
1: 0
2: 4
3: 51
4: 629
Right 950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG 0: 1
1: 0
2: 3
3: 25
4: 244
950507836_950507842 21 Left 950507836 3:13406725-13406747 CCTCTAAAAGGACACTTGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 132
Right 950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG 0: 1
1: 0
2: 3
3: 25
4: 244
950507834_950507842 26 Left 950507834 3:13406720-13406742 CCACTCCTCTAAAAGGACACTTG 0: 1
1: 0
2: 0
3: 26
4: 187
Right 950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG 0: 1
1: 0
2: 3
3: 25
4: 244
950507837_950507842 1 Left 950507837 3:13406745-13406767 CCTCTTACCTGCACACCTGTCCT 0: 2
1: 0
2: 1
3: 30
4: 316
Right 950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG 0: 1
1: 0
2: 3
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950507842 Original CRISPR CTTCTCTGCACCTCAGCAGG TGG Intronic
900479918 1:2893111-2893133 CTCCTCTGCCCCTCAGCCAGGGG - Intergenic
900628062 1:3618470-3618492 CACCTCTGCACCCCAGCAGGAGG - Intergenic
900807106 1:4774686-4774708 CTTCTCTGAACATGAGCCGGCGG + Intronic
900959491 1:5909990-5910012 AGCCCCTGCACCTCAGCAGGAGG + Intronic
902125082 1:14202482-14202504 CTTCCCTGCACCCCAGCACCTGG - Intergenic
902231388 1:15029867-15029889 CTTCTTTCCACCGGAGCAGGAGG + Intronic
902642545 1:17776007-17776029 CTTCCCTGAACCTCAGCATCTGG - Intronic
903335238 1:22620181-22620203 CTCCTTTGCTTCTCAGCAGGAGG - Intergenic
903555936 1:24193419-24193441 CTCCTCTGCAACCCAGCAGTGGG - Intergenic
904303170 1:29569249-29569271 CTTCCCTGGCCCTCAGCATGGGG - Intergenic
905906653 1:41622972-41622994 CTTCTCTGTGCCTCATCAGTAGG - Intronic
906345023 1:45009680-45009702 CGTCTCTGCCCCTCCCCAGGAGG - Exonic
907528638 1:55070545-55070567 CTTCTCTCCAACTCAGCAGTTGG - Intronic
908006620 1:59734827-59734849 CTTCTCTGCTCAGAAGCAGGAGG - Intronic
908490377 1:64637533-64637555 CTGCACTGCACATGAGCAGGAGG + Intronic
912159004 1:106957946-106957968 CTTTTGTTCAACTCAGCAGGAGG - Intergenic
913070034 1:115290277-115290299 CTGCTCTCCACCTCTGCTGGTGG + Intronic
916273890 1:162972670-162972692 CGTCTCTGCTCCTCAGCTGCAGG - Intergenic
916438276 1:164797089-164797111 CTTTGCTCCACCTCAGCAGTGGG + Intronic
918940005 1:190981582-190981604 CTTCTTTGCTCCTCAGCTTGTGG - Intergenic
919915776 1:202138213-202138235 TTTCCCAGCTCCTCAGCAGGGGG + Intronic
920060638 1:203224870-203224892 GTTCTTGGCACCTCAGCTGGAGG - Intronic
920678184 1:208052995-208053017 CTTCTCAGACCCTCATCAGGAGG + Intronic
920700405 1:208213918-208213940 CTTCTCTGCTCCAGAGCAGAGGG - Intronic
922000611 1:221473879-221473901 CTTCCCTGCAGCTCACCATGGGG - Intergenic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
923226718 1:231944530-231944552 CTTCTCTGCACTTTCACAGGTGG + Intronic
923342659 1:233021151-233021173 CTTTTCTGCCCTTCAGCAAGGGG - Intronic
1063580552 10:7302426-7302448 CCACTCTGCTCCTCAGCATGTGG - Intronic
1063593180 10:7411233-7411255 ATTCCCTGCGCCTAAGCAGGCGG + Intronic
1064255869 10:13742342-13742364 CGACTCCACACCTCAGCAGGTGG - Intronic
1064298769 10:14103146-14103168 CATCTCTTCACTTCAGCAGTAGG - Intronic
1067274025 10:44818845-44818867 CCTCTCAGCAGCTCAGCTGGTGG - Intergenic
1068135345 10:52947522-52947544 CTTAACTGCAACTCAGCGGGGGG + Intergenic
1068593574 10:58876302-58876324 CTTCTCTCTACCTCAACAGGAGG - Intergenic
1069746025 10:70715571-70715593 CAGCTCTCCACCTCAGCAGTGGG - Intronic
1070573244 10:77657507-77657529 CAGCTCTGCACCTCATCAGCAGG + Intergenic
1070665728 10:78342140-78342162 CCTCTCTGCACCTTAGCATGCGG + Intergenic
1072207617 10:93218426-93218448 CATGTCTGCACCCCAGCAGCTGG + Intergenic
1072797861 10:98370079-98370101 CCTCTCTCAACCTCAGCAGGAGG + Intergenic
1073347554 10:102795488-102795510 CTTCTGTGCACCGAGGCAGGGGG - Intronic
1073362611 10:102912286-102912308 CTTGTCCACACCTGAGCAGGAGG + Intergenic
1074666423 10:115731239-115731261 CTTTCCTGCCCCACAGCAGGTGG + Intronic
1074788154 10:116859890-116859912 CTTCTCTGGGCCTCAGCATCTGG - Intronic
1075742182 10:124702670-124702692 CACCCCTGCCCCTCAGCAGGTGG + Intronic
1076068309 10:127466164-127466186 CTTCTCAACACCCCATCAGGTGG + Intergenic
1076426373 10:130370214-130370236 CTCCTCTCCACCTCTGCAGGGGG - Intergenic
1076518155 10:131061725-131061747 CTGCTCTCCAGCTCTGCAGGAGG - Intergenic
1076657591 10:132035340-132035362 CTTCTCTGCAGGTCCTCAGGTGG - Intergenic
1076661479 10:132058507-132058529 GTTCTCTGCTCCGCAGCAGATGG - Intergenic
1077488244 11:2848813-2848835 CTTCTCTGCGGCTCAGCAGCTGG - Exonic
1079259153 11:18861110-18861132 CCTCTCTCCACCTCCACAGGAGG - Intergenic
1079266470 11:18938062-18938084 CTTCTATGCACCACATCAGTGGG + Intronic
1079871292 11:25801439-25801461 CTTCCCTGCTCCTCAGCTTGCGG - Intergenic
1080757912 11:35219884-35219906 ATTCTGTCCACATCAGCAGGCGG - Intronic
1080792857 11:35537050-35537072 CTTCCCTGCAATTCAGGAGGGGG - Intergenic
1081068367 11:38576922-38576944 CTTCCCAGCACCACTGCAGGAGG - Intergenic
1083323682 11:61862699-61862721 CATGGCTGCCCCTCAGCAGGAGG + Intronic
1083334329 11:61913967-61913989 CTACTCTACCCCTCAACAGGTGG - Intronic
1083389184 11:62335511-62335533 CTTCTCTTCCCTTCAGCATGTGG - Intergenic
1083396378 11:62395439-62395461 CTTCTCTGCAGCCCAGCAGTGGG - Intergenic
1083404824 11:62449367-62449389 CTTTTCTACAGCTGAGCAGGGGG - Intronic
1083941108 11:65896430-65896452 CCTCTATGCATGTCAGCAGGTGG + Intronic
1083951716 11:65960124-65960146 CTTCTCTGCTCCTGAGGAGTGGG + Intergenic
1085303766 11:75473702-75473724 CGTCCCTGCACCTGAGCCGGTGG + Intronic
1085526659 11:77167908-77167930 CTTGTGTGCACCCCAGCAGTCGG - Intronic
1086356029 11:86000697-86000719 CCTGTATCCACCTCAGCAGGAGG - Exonic
1088537358 11:110875853-110875875 CTTCTGTGCAGCTCAGAATGGGG - Intergenic
1088986467 11:114913717-114913739 CATCTCTGCACCTGAGCTGTAGG + Intergenic
1089848910 11:121480555-121480577 TATCTGTGCACCACAGCAGGAGG - Intronic
1095375006 12:41516289-41516311 ATTATCTGCACATCACCAGGAGG + Intronic
1095521613 12:43073628-43073650 CTTCTCAGCACCTCTGCACATGG + Intergenic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096243469 12:49971875-49971897 GTTTTCTGCAGCTCAGCTGGTGG - Intronic
1096564867 12:52469920-52469942 CTTGTCTGCTCCTCCGGAGGAGG + Intronic
1097076232 12:56397003-56397025 CCTCTCTGCATCTCTGCAGCTGG + Intergenic
1097248969 12:57621915-57621937 CCTCTCTGCACTCCACCAGGGGG - Intronic
1098731426 12:74040372-74040394 CTTCCCTGCTCCTCAGCTTGTGG + Intergenic
1100515575 12:95324446-95324468 CTTCGCTTCAACTCAGGAGGCGG - Intergenic
1101025022 12:100593813-100593835 CTTCTCTCCACCACAGCAAAAGG - Intronic
1101441067 12:104704548-104704570 TTTCTCTGCCTCTCAGCTGGAGG + Intronic
1102584266 12:113912180-113912202 CTTCTCTCCCCTCCAGCAGGCGG + Intronic
1104313395 12:127675214-127675236 CTTGTCTGGACTTCCGCAGGAGG - Intergenic
1106956368 13:34942794-34942816 CTTCCCTTCTCCTCAGGAGGGGG + Exonic
1107017067 13:35716138-35716160 CTTTTCTGCACCTCAGTCTGTGG + Intergenic
1107417239 13:40211954-40211976 CTGCTCTGCCCCTAAGCAGTAGG + Intergenic
1108118602 13:47159490-47159512 CATATCTGCATCTCATCAGGAGG - Intergenic
1108123068 13:47210637-47210659 ACTCTCTGCACCTTAGCTGGGGG + Intergenic
1110885656 13:80631043-80631065 CTTCTCAGCACTTCAGGATGTGG - Intergenic
1112208332 13:97347433-97347455 CATTTCTGCACCTGAGCACGAGG + Intronic
1112387265 13:98951505-98951527 CTTCTCAGGACCACAGCACGGGG + Intronic
1113191758 13:107756716-107756738 CTTTTTTGCACCTCCGTAGGAGG - Intronic
1113244972 13:108384967-108384989 CTTCTAAGTACCTCAGCAGGAGG + Intergenic
1113503950 13:110800138-110800160 CTTCCCTTCACCACAGCAGCTGG + Intergenic
1114349720 14:21836324-21836346 CTTCTCTGCCCAGGAGCAGGAGG - Intergenic
1117534436 14:56690233-56690255 CCACTCTGCACCCCAGCAAGTGG + Intronic
1118613857 14:67562173-67562195 CTGCTCTGCAGCTCCGTAGGGGG - Exonic
1119503130 14:75147865-75147887 ATTTTCTGCAACTGAGCAGGGGG - Intronic
1121495363 14:94388432-94388454 CTGCCCTGCACCTCAGCAGGCGG + Intronic
1121886068 14:97544011-97544033 GTTCTCTGAACCACAGCAAGTGG - Intergenic
1123007817 14:105332872-105332894 CTTCTCTGCCCCACATCAAGAGG - Intronic
1124222974 15:27865777-27865799 CTTCTCTCTACATCAGCAGCAGG + Intronic
1124617219 15:31250307-31250329 CCTCCCTGCCCCTCAACAGGGGG - Intergenic
1127670751 15:61192510-61192532 CCTCTCTGCAGCTCAGCACTGGG + Intronic
1128683480 15:69667642-69667664 CCTCTCTGGACCTCAGCACTGGG + Intergenic
1130902029 15:88214526-88214548 CTACTCTGCAGCTCAGAATGTGG - Intronic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1131027668 15:89158449-89158471 CTTCTCTGCTCTTCAGCTGCTGG - Intronic
1131449498 15:92527627-92527649 CTTCTCTGCACTTCAGACGGAGG + Intergenic
1132679970 16:1135821-1135843 CATCCCAGCACCTCGGCAGGTGG - Intergenic
1132725968 16:1338472-1338494 CCTCCGTGCACCACAGCAGGCGG - Intronic
1133170567 16:3980389-3980411 CTTCTCTTCACCTCCCCATGTGG - Intronic
1135105475 16:19645678-19645700 CAGCTCTGCAGCCCAGCAGGTGG + Intronic
1137553409 16:49455519-49455541 CCTCTGTCCACCTCAGCGGGAGG + Intergenic
1137594050 16:49712208-49712230 CTTCTCTGCTCCTCACTTGGAGG + Intronic
1138548150 16:57731588-57731610 CTTCACAGCACCTCTGCAGATGG + Intronic
1140232216 16:73126728-73126750 CTTCTCACCACCTCAGGGGGCGG - Exonic
1140643338 16:77002660-77002682 TTTGTCTGCCTCTCAGCAGGTGG - Intergenic
1141175123 16:81713649-81713671 CTGCTCTGCCCCGCAGCAGCTGG + Intergenic
1141417532 16:83887950-83887972 CTTCTCCCCACCTCAGCTGAAGG + Intergenic
1144004093 17:11084349-11084371 CTTCTCTGAACCTCATCATCAGG - Intergenic
1144946159 17:18970520-18970542 CTTCTCTGTGCCTCAGGGGGTGG + Exonic
1145829781 17:27906719-27906741 CTTCTGTGCACCTCTGCATGGGG + Intergenic
1145870715 17:28271045-28271067 CCCCTCTGCAGCCCAGCAGGAGG - Intergenic
1146638261 17:34521826-34521848 CCTCTCAGGAGCTCAGCAGGAGG + Intergenic
1147163417 17:38580466-38580488 CTTCCCTACACCCCATCAGGTGG + Intronic
1147185178 17:38709387-38709409 CTTGGCTTCGCCTCAGCAGGGGG + Intronic
1147186047 17:38713537-38713559 GTTCTGGGCACCTTAGCAGGAGG + Intronic
1147197036 17:38773923-38773945 CTTCTCAGAACCACAGTAGGGGG + Intronic
1147256178 17:39183849-39183871 TCACTCTGCACCTCAGCTGGGGG + Exonic
1147363492 17:39945564-39945586 CTTCACTCCCCCTCAGCTGGGGG - Intergenic
1147454104 17:40524432-40524454 CTTCTCTGTGCCTCTGCTGGTGG - Intergenic
1149576056 17:57714430-57714452 CTTCTCTGAGCCTGAGTAGGTGG + Intergenic
1149986661 17:61352826-61352848 CTTCTCTGCACAGCTGCAGAGGG - Intronic
1151976028 17:77483924-77483946 CTTGCCTGCACCTCTGCAGGTGG - Intronic
1153457726 18:5297432-5297454 CTTCTCTAAACCTCAGCTGAAGG + Intergenic
1153995727 18:10440020-10440042 CTTCTCTAAAGCTCAGAAGGAGG - Intergenic
1157625003 18:49044107-49044129 CTTGTCTACAACTCAGCAGTCGG - Exonic
1159271607 18:66159996-66160018 CTTTTTTGCACTTCAGCTGGTGG + Intergenic
1159831842 18:73286624-73286646 CATCTCTGCACCGAAGCAGCAGG + Intergenic
1160381303 18:78458262-78458284 CTTCTCTGAACCTGGGAAGGAGG + Intergenic
1160557504 18:79735679-79735701 CCTCCCCGAACCTCAGCAGGCGG - Intronic
1160685107 19:430948-430970 CTTCTCTCCACCTCGGAAGGTGG + Intronic
1163087764 19:14994572-14994594 TTGCTCTGCACCCCAGAAGGTGG + Intronic
1164524995 19:29007179-29007201 AGTCTCAGGACCTCAGCAGGTGG - Intergenic
1166104518 19:40590714-40590736 CTTCCGTGCCCCCCAGCAGGTGG + Exonic
1166168589 19:41010172-41010194 CATTTCTGCAGCTCAGAAGGAGG - Intronic
1166369531 19:42293237-42293259 CTGGTCCGCTCCTCAGCAGGTGG - Exonic
1167516044 19:49923776-49923798 CTTCTGTGACCCTCAGCAAGTGG - Intronic
1167752590 19:51389579-51389601 TGTCTCTGCACCTCTGCAGAAGG + Intronic
925497927 2:4472985-4473007 CTTCCCTGCTCCTCAGCTTGGGG - Intergenic
925855221 2:8122989-8123011 CTTGTCTGCACCTGTGCATGTGG - Intergenic
928387518 2:30883143-30883165 CTTCTCAGCACCTCCCCATGTGG + Intergenic
928689950 2:33788879-33788901 TTTCTCTGCTTCTCAGCAAGTGG + Intergenic
928983086 2:37156370-37156392 CTTCTCCACACCTCAGCATCTGG - Intronic
929903325 2:46024647-46024669 CTTCCCTGGACTTCAGAAGGAGG + Intronic
931515001 2:63045214-63045236 CTTCTCGGCCCCTCGGCAGGTGG - Intronic
932035105 2:68236956-68236978 CTCCTCTGCATGTCAGCAGAGGG - Intronic
932716895 2:74107224-74107246 CTTGCCTGCAGCTCTGCAGGAGG - Exonic
935650789 2:105380171-105380193 ATTCTCTGAGTCTCAGCAGGAGG + Intronic
936245757 2:110825899-110825921 TTTCTGAGCACATCAGCAGGAGG + Intronic
937348424 2:121142896-121142918 CATTTCTCCACCTGAGCAGGAGG + Intergenic
937425062 2:121791976-121791998 TTTCTCTGCACCACAGCATGAGG - Intergenic
940898473 2:159104112-159104134 CTCCTATTCACCTCAGCAGGAGG - Intronic
941652162 2:168103477-168103499 CTTCTTTGTACCTTAGTAGGAGG + Intronic
942155002 2:173119320-173119342 CCTCCCAGCACCCCAGCAGGTGG - Intronic
942732352 2:179074296-179074318 CTTCTTTGCTCCTCAGCTTGCGG + Intergenic
945222438 2:207498632-207498654 CTTCTCTGCCCCTCTGCACGAGG - Intergenic
948074944 2:235158785-235158807 CTCCTCTGCTCCTCAGAAGGTGG - Intergenic
1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG + Intronic
1170909631 20:20552726-20552748 CATTTCTGAACTTCAGCAGGTGG - Intronic
1170942282 20:20858389-20858411 TTTCTCAGCACCTGAGCGGGAGG + Intergenic
1172512262 20:35508924-35508946 CTTATTTGCACCTTGGCAGGTGG + Exonic
1172933160 20:38600510-38600532 CTTGTCTCCTCCTCAGGAGGAGG + Intergenic
1173265252 20:41473398-41473420 CTTCTGTGCACCAGAGCGGGAGG - Exonic
1173357023 20:42303050-42303072 TTTCTCTGCACCTCATGAAGAGG + Intronic
1173674968 20:44825635-44825657 CTACTGTCCACCTCAGCTGGGGG - Intergenic
1173972964 20:47166744-47166766 CTTCTCCTCACCTCATCTGGAGG + Intronic
1174357730 20:50009738-50009760 CTTCTCTGAGCCTTTGCAGGAGG - Intergenic
1174920535 20:54697227-54697249 CTTCTCAGCACCTCTGAAGAGGG + Intergenic
1174954910 20:55086831-55086853 CTTCTCTTCACCTCTACAGCAGG - Intergenic
1177903410 21:26945865-26945887 CTTTGCTTCACCTCAGCAAGGGG + Intronic
1178761348 21:35405581-35405603 CTTGTGTGCAACACAGCAGGAGG - Intronic
1179842068 21:44083236-44083258 CGTGGCTGCACCTCAGCACGTGG - Exonic
1179908490 21:44436128-44436150 CTCCTCTGCACTCCAGCAGCTGG + Intronic
1181025473 22:20124970-20124992 CTTCTCTGCATTTCTGGAGGTGG + Intronic
1183830942 22:40418113-40418135 CATTTCGGCACCTCAGCAGCAGG - Intronic
1184365256 22:44047015-44047037 CCTCTCTTCACCTCTGCCGGTGG - Intronic
1184872670 22:47250954-47250976 CTTCTCTTCACCTCTGAAAGGGG - Intergenic
950211586 3:11127216-11127238 GTTCTCTGCACCGCAGCCAGAGG - Intergenic
950448890 3:13054665-13054687 CTTCTCTGCGCCTCAGCCTCAGG - Intronic
950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG + Intronic
950579038 3:13850823-13850845 CTTCTCTGCACTCCTGCAGGGGG + Intronic
950610434 3:14123673-14123695 CTTCTCTGCGCCAGAGAAGGGGG - Intronic
954441657 3:50525496-50525518 CTTCTTGGCACCTCAGCTGGGGG + Intergenic
954455935 3:50599890-50599912 CTTCCCTGTCCCACAGCAGGGGG - Intergenic
954714395 3:52519925-52519947 CTTTGCTGCACCCCACCAGGTGG + Exonic
954749877 3:52807425-52807447 CTTCTCTGAGCCTCAGTGGGAGG - Intronic
960743078 3:120856226-120856248 CTTCTCTGCATAGCAGCAGAGGG + Intergenic
962714427 3:138114839-138114861 CTGGGCTGGACCTCAGCAGGAGG - Intronic
965057320 3:163738073-163738095 CTGCTGTGTACTTCAGCAGGGGG + Intergenic
965379560 3:167971324-167971346 TTTCTCTGCACATTAGCTGGTGG + Intergenic
966665355 3:182465219-182465241 CTTCTCTGCACCACTCCAGAGGG + Intergenic
967530891 3:190547954-190547976 CTTCTGGGCACCTGAACAGGAGG + Intronic
968248682 3:197183806-197183828 CATCTCTGCAGCCCTGCAGGTGG + Intronic
968463128 4:735833-735855 CTTGCCTGGACGTCAGCAGGAGG + Intronic
968973760 4:3810551-3810573 CCGCTCTGCAGCTCGGCAGGGGG - Intergenic
973832854 4:54779377-54779399 TTTCTCTGCACCTCAGCTGATGG - Intergenic
974617197 4:64305612-64305634 CTTGTCTGTGCCTCTGCAGGTGG - Intronic
974617543 4:64308289-64308311 CTTGTCTGTACCTGCGCAGGTGG - Intronic
976705400 4:88014325-88014347 CTTGTCTGCACCTCAGGAGATGG + Intronic
977753327 4:100635260-100635282 CTTCTCTGCTCCTCAAGTGGAGG - Intronic
978276739 4:106960086-106960108 TTTCTCTGCACATCAGCTGATGG - Intronic
984747407 4:183235500-183235522 CTTCTGTACACCTCAGCACCTGG + Intronic
986248656 5:6034234-6034256 CCTTTCTTCACCCCAGCAGGAGG - Intergenic
986929343 5:12798184-12798206 TTGCTCTGCATCTCAGCAAGAGG - Intergenic
988183577 5:27830827-27830849 CTTTTCTGCAGTTCAGAAGGAGG + Intergenic
990263243 5:54048067-54048089 CTTCTGTGCTCAACAGCAGGGGG - Intronic
992015101 5:72567537-72567559 CTCCTCTGGATCTCAGCAGAGGG - Intergenic
992747616 5:79835110-79835132 CTTTCCTGGCCCTCAGCAGGTGG - Intergenic
994551631 5:101241243-101241265 CTTCTCTGCACTACTGCTGGAGG - Intergenic
998340431 5:141413028-141413050 CTTCCCTGCAGCCCAGCAGCCGG - Intronic
999722952 5:154412376-154412398 GTTCTTTGGATCTCAGCAGGGGG + Intronic
1001760638 5:174205225-174205247 CATCCCTGCCCCTCTGCAGGAGG - Intronic
1005070784 6:21860590-21860612 CATGTCTCCATCTCAGCAGGAGG + Intergenic
1005567680 6:27113143-27113165 CTCCTCTACAGCACAGCAGGTGG + Intergenic
1007088555 6:39167630-39167652 CCTCTCTGCCCCACAGCAGCGGG + Intergenic
1007312264 6:40955812-40955834 CTTCTCTGGACCTCAGGATCAGG - Intergenic
1011217026 6:85015820-85015842 CTTTTCTCCAACTCAGCATGAGG - Intergenic
1012848389 6:104418459-104418481 CTTCTCTCCACCTGATCATGGGG + Intergenic
1013437261 6:110123064-110123086 CTTCTCTAACCCTCATCAGGTGG - Intronic
1013650414 6:112188965-112188987 CCTTTCTGCACCTCAGCAAATGG - Intronic
1013753043 6:113428939-113428961 CTTCTCTGCAGCTAAGTATGTGG - Intergenic
1014127782 6:117796232-117796254 TTCCTATGCACATCAGCAGGAGG + Intergenic
1017131351 6:151110804-151110826 CTTCTCTGCGGATGAGCAGGGGG + Intergenic
1017673246 6:156787882-156787904 TTTCTCTGCACTCCAGCAGGGGG + Intronic
1018569538 6:165194643-165194665 CTTCCCTGCTCCTCAGCTTGCGG + Intergenic
1018657990 6:166058352-166058374 CCTCTCTGCACATCACCACGTGG + Intergenic
1020954102 7:14718381-14718403 TTTGTCTGATCCTCAGCAGGAGG + Intronic
1021577378 7:22116605-22116627 CTTCCCAGCACCTAAGCAGCAGG - Intergenic
1021698119 7:23293151-23293173 CTGCTGTGTACCACAGCAGGTGG + Intergenic
1022248660 7:28585453-28585475 CATCTCAGCCCCTCAGCCGGAGG + Intronic
1023017790 7:35984033-35984055 CCTCTCTCCTCCTTAGCAGGTGG + Intergenic
1024474732 7:49798480-49798502 CCTCTCTGTATCTCAGGAGGTGG + Intronic
1026439343 7:70430319-70430341 GTTCGCTGCACTTCAACAGGGGG + Intronic
1026865529 7:73821885-73821907 CTTCTCTCCAACTGAGCAGGGGG - Intronic
1029304293 7:99607405-99607427 CACCTCTGCACCTTAGCAGAGGG - Intronic
1029415804 7:100442425-100442447 CTTTTCTGCATCCCAGCAGCTGG - Intergenic
1029646418 7:101859223-101859245 CCTCCCTGCACCTGAGCTGGGGG + Intronic
1032548054 7:132759757-132759779 CTTCTCTGCTCCTCACCAGGAGG + Intergenic
1033503247 7:141975016-141975038 CTTGTCTTCACCACACCAGGTGG + Intronic
1038000950 8:23390725-23390747 CTTCTCTGCAGCTCATAAAGGGG + Intronic
1038312741 8:26457261-26457283 CTGCTCTGCACCTCAGCAGTTGG + Intronic
1042205901 8:66329310-66329332 AATCTCTGCAACTCAGGAGGCGG + Intergenic
1045242688 8:100416273-100416295 CTCCTCTCCACCACAGCATGAGG - Intergenic
1045814625 8:106265216-106265238 CTTCTCTGAGCCTCAGGAGGTGG - Intergenic
1047725099 8:127677422-127677444 CTTCTCTGGTCCTCATCATGTGG - Intergenic
1048317642 8:133374214-133374236 GTGCTCTGCACCTCACCACGTGG - Intergenic
1049415385 8:142492619-142492641 CTTCTCTGCACCCCACATGGTGG + Intronic
1049429188 8:142551300-142551322 CTTCTCTCCAAGCCAGCAGGGGG - Intergenic
1049720271 8:144112375-144112397 CAGCTCTGCCCCTCAGTAGGTGG - Intronic
1049832367 8:144710110-144710132 CTTCTCTGCACCTCAGGCCTTGG - Intergenic
1050409984 9:5353763-5353785 CTTCTCTGCACTTGAGGTGGAGG - Intergenic
1052518711 9:29514982-29515004 CTTCTCTCCTGCTCTGCAGGTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1059611968 9:115908149-115908171 CTTCTCATCACCTCAGCAATCGG + Intergenic
1060194946 9:121617528-121617550 CTTCTCTGCACCTCACCCAAGGG + Intronic
1062571071 9:137185629-137185651 CCAATCTGCACCTCAGTAGGGGG + Intronic
1187510587 X:19914153-19914175 CATCTCAGGACCTCAGCAGAAGG - Exonic
1189197863 X:39166886-39166908 TTTCTCAGCACTCCAGCAGGAGG - Intergenic
1192165296 X:68824100-68824122 CTGCTCTCCAGCCCAGCAGGAGG - Intergenic
1193033415 X:76923958-76923980 AGTCTCTGCCCCTGAGCAGGAGG - Intergenic
1197423742 X:126269830-126269852 CTTCTCTGTACCTCATTATGAGG - Intergenic