ID: 950509142

View in Genome Browser
Species Human (GRCh38)
Location 3:13415312-13415334
Sequence GTGCTTGTCCCCTGGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950509136_950509142 12 Left 950509136 3:13415277-13415299 CCAGCCCTCCTCGGTGAAATATG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 157
950509138_950509142 7 Left 950509138 3:13415282-13415304 CCTCCTCGGTGAAATATGTGTCG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 157
950509139_950509142 4 Left 950509139 3:13415285-13415307 CCTCGGTGAAATATGTGTCGTCC 0: 1
1: 0
2: 0
3: 3
4: 23
Right 950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 157
950509137_950509142 8 Left 950509137 3:13415281-13415303 CCCTCCTCGGTGAAATATGTGTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950509142 Original CRISPR GTGCTTGTCCCCTGGTGCTC AGG Intronic
900141786 1:1141784-1141806 GTGCCTGTCTCCTGGGGCTCGGG - Intergenic
900850432 1:5138373-5138395 CTTCTTGTCCCTTGATGCTCAGG + Intergenic
901449547 1:9327594-9327616 GTGCTTGCATCCTGGTGCACTGG - Intronic
901665670 1:10824874-10824896 GTGGGTGTCCCCTGGGGCCCAGG + Intergenic
904533598 1:31184487-31184509 GTGCTTGGCCCCTGGTCGGCAGG - Intronic
905624101 1:39475604-39475626 GTGCATGCCCCCTTGTACTCAGG - Intronic
905815732 1:40949375-40949397 GTGCCAGGCCCCTGGTGCTGGGG - Intergenic
907471164 1:54674318-54674340 GCCTTTGTCCCCTGGTTCTCTGG - Intronic
910383526 1:86657400-86657422 GTGCTTGTCTCCTTGGGCTGTGG - Intergenic
910387927 1:86704966-86704988 GTGCAGGTACCCTGGTGCTGGGG + Exonic
919072484 1:192773481-192773503 ATGATTGTCCCCTTGTGCTCTGG + Intergenic
920186524 1:204162709-204162731 GTGCCTGTCCCCTGGTATCCTGG - Intronic
920515958 1:206584787-206584809 CAGCTGGACCCCTGGTGCTCAGG - Intronic
920792933 1:209109892-209109914 GTGCTTGTGCCCTTGGGATCAGG - Intergenic
922500240 1:226091960-226091982 GTGGTTTTCCCATGTTGCTCAGG - Intergenic
922616665 1:226964922-226964944 CTGCCTGTCCCCTGCTGCCCAGG - Intronic
923621471 1:235582855-235582877 ATTCTTTTCCCCTGGAGCTCTGG - Intronic
924852161 1:247841442-247841464 GTGGTGGTCTCCTGGTGCACAGG - Exonic
1063879589 10:10517517-10517539 GTGCCTGTCTCCTGGAGTTCAGG + Intergenic
1065625934 10:27628330-27628352 TTGCTGGTAGCCTGGTGCTCGGG + Intergenic
1067037039 10:42928273-42928295 GTGCTGGTCCCCAGGTCCTGAGG - Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067092374 10:43274551-43274573 GTACCTGTCTCCTGGTGCCCAGG + Intergenic
1067499817 10:46793299-46793321 CTGCTTGTCCCTTGGCACTCTGG + Intergenic
1067594814 10:47547026-47547048 CTGCTTGTCCCTTGGCACTCTGG - Intronic
1067641922 10:48055136-48055158 CTGCTTGTCCCTTGGCACTCTGG - Intergenic
1069134569 10:64747776-64747798 GTATTTGTCCACTGTTGCTCTGG + Intergenic
1069958205 10:72064267-72064289 GGGACTGTCCCCTGGTGCTGGGG + Intronic
1071692229 10:87833034-87833056 GTGCTTGAGCCCAGGAGCTCTGG - Intronic
1072564736 10:96608056-96608078 GTGCTTTTCCCCTTGTGCAGTGG - Intronic
1073096960 10:100985653-100985675 GAGCCTGTCCCCTGGTGATCAGG - Intronic
1073124911 10:101143128-101143150 GTGTTTGTCCTCTAGAGCTCTGG + Intergenic
1074123146 10:110508207-110508229 CTGCTTGTCCCCTGAGCCTCTGG + Intronic
1075435196 10:122434153-122434175 GTGTTTGTCCACTGCTGCTATGG + Exonic
1077135704 11:997266-997288 GTGCGTGTCCCCGGGTGTGCTGG + Intronic
1077306348 11:1870326-1870348 GTGTATGTCCCCGGGTGCTGCGG - Intronic
1077366152 11:2162147-2162169 CTGCTTGTCCCCAGGTCCCCAGG - Intergenic
1078562703 11:12387256-12387278 GTGCTGGTGCTCTGGTCCTCAGG - Intronic
1078956962 11:16209626-16209648 GTGCCTGTCCCCAGCTACTCAGG + Intronic
1079335355 11:19565915-19565937 GTGTTTCTCCTCTGGAGCTCTGG + Intronic
1081574263 11:44309564-44309586 GTGCGGGTCACCTGGTGCTGGGG - Intronic
1081795666 11:45817665-45817687 CTGCTTCTCCCCTAGTGCTTGGG - Intergenic
1083138803 11:60704517-60704539 GTGTTTTTCTCCTGGAGCTCAGG - Intronic
1084290387 11:68161798-68161820 GTGCTTGTCACCTGGGGCCTAGG - Intronic
1084359020 11:68657524-68657546 GTGCTTGTGCCCTTGTCCTGAGG - Intergenic
1084453909 11:69256472-69256494 CTCCTTGTCCCCTGGTGATATGG - Intergenic
1084652668 11:70498381-70498403 GTGCTTGGACCCTGGTGGACTGG + Intronic
1085040252 11:73322661-73322683 GAGCCTCTCCCCAGGTGCTCTGG - Intronic
1085982075 11:81737264-81737286 GTACTTGTCCACAGGTCCTCAGG + Intergenic
1088016417 11:105066152-105066174 GTTCTTGTCTCATGGTGTTCGGG - Intronic
1089921365 11:122212689-122212711 GTGCTGGCGCCCTGGAGCTCAGG + Intergenic
1089992963 11:122878970-122878992 GTCCTTGTTCTCTGGTTCTCTGG + Intergenic
1092955615 12:13546879-13546901 GAGCATGTGTCCTGGTGCTCTGG - Exonic
1095939761 12:47718270-47718292 TTGCTTGTCCCCTGAGGCTGGGG - Intronic
1097247507 12:57614675-57614697 GTCCCTGTCCCCAGGAGCTCCGG + Exonic
1098874240 12:75850414-75850436 GTACTTGTTCCCAGGTACTCAGG - Intergenic
1099786852 12:87275661-87275683 GAGCTTGTCCCTTGGTGCTATGG - Intergenic
1102562135 12:113769722-113769744 GGTTTTGTCCCCTGTTGCTCTGG - Intergenic
1105242011 13:18616584-18616606 CTGTTTTTCTCCTGGTGCTCTGG + Intergenic
1105831282 13:24164853-24164875 GCTCTTGTCCCCTGGTCCCCTGG - Intronic
1105930097 13:25044281-25044303 CTGATTGTCTCCTGGTGCTGGGG - Intergenic
1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG + Intergenic
1108240477 13:48458110-48458132 CTGCTTGTCCCCGGCTCCTCCGG + Intronic
1108629680 13:52269315-52269337 GTGATTGTCCAATCGTGCTCAGG - Intergenic
1110425105 13:75358088-75358110 GAGGATGCCCCCTGGTGCTCTGG + Intronic
1118344272 14:64924840-64924862 TTGCTTGTCTCCTGGTTCTTGGG + Intronic
1118813522 14:69292464-69292486 GTGCTCCTTCCCTGGGGCTCTGG - Intronic
1119906381 14:78306543-78306565 GTGCATTTCCCCTTGTGCTTAGG + Intronic
1122074931 14:99229925-99229947 GTGCTGGTCCCCAGGTGCTCAGG - Intronic
1122364670 14:101187507-101187529 GTGCCAGTCCCCTGGTGCTGAGG + Intergenic
1122602517 14:102928718-102928740 GCGCTTGTTCCGTGGAGCTCAGG + Intronic
1123948590 15:25250747-25250769 GTGCTAATCCCCCAGTGCTCTGG + Intergenic
1124555217 15:30719106-30719128 TTGCTTGTCTCCTCGTCCTCTGG + Intronic
1124676035 15:31686575-31686597 TTGCTTGTCTCCTCGTCCTCTGG - Intronic
1125680487 15:41527376-41527398 GTGCTTGTCCCCTGGGCCATGGG + Intronic
1126785706 15:52176487-52176509 GTGTTTGTCCCTTGGCACTCAGG - Intronic
1128728344 15:70004410-70004432 GTGCCTGGCCCCTGCTCCTCTGG + Intergenic
1128983325 15:72201709-72201731 GAGCTTGTGTCCTGGTTCTCTGG + Intronic
1130701522 15:86187578-86187600 GTGCTTGTCCTATGGAGCTGTGG + Intronic
1131559424 15:93426604-93426626 ATGCTTTTCCCTGGGTGCTCAGG + Intergenic
1132352859 15:101150668-101150690 GTGCTTGTCCCCGGTTGGACTGG - Intergenic
1137647462 16:50088506-50088528 GTGCTTGTCCCGTCCTGCCCTGG - Intronic
1138445011 16:57058239-57058261 GTCCTTGTCCTCTGGTGCTCTGG - Intronic
1141655605 16:85414554-85414576 GGGCTTGTGCCCTGGGGCTTTGG + Intergenic
1141944279 16:87298759-87298781 GTGCCTGTGCCCTGGCACTCTGG + Intronic
1142144033 16:88485252-88485274 GGGCCTGTCCCCTGGTGCTGGGG + Intronic
1143125272 17:4637949-4637971 GTGACTGGCCCCTGGTGCTAGGG - Intronic
1143403234 17:6659160-6659182 GTGACTGGCCCCTGGTGCTAGGG + Intergenic
1148257515 17:46148709-46148731 GTGCTTGTACCCAGCTGTTCAGG - Intronic
1150599769 17:66640749-66640771 GTGCTTGTCCCCAAGGGCTTTGG + Intronic
1152824968 17:82458864-82458886 GTGCTTGTCCTGTGGGGCTCTGG + Intronic
1154446939 18:14443294-14443316 CTGTTTTTCTCCTGGTGCTCTGG - Intergenic
1155170934 18:23266513-23266535 GTTCTTGTCCCCCACTGCTCAGG + Intronic
1157136544 18:45062411-45062433 GTGCTTTTCCCCCAGTGTTCTGG - Intronic
1157325939 18:46668939-46668961 GTGCTGGCCCCCTGCTGCTCTGG - Intronic
1157901614 18:51523492-51523514 TTGCTTGACCCTTGCTGCTCTGG + Intergenic
1158436964 18:57440694-57440716 GTGCTTGTCTCCCGCTGCGCCGG + Intronic
1158519769 18:58162232-58162254 GTGCTTCTCCCCCAGTGGTCGGG + Intronic
1160057245 18:75495034-75495056 AGGCAGGTCCCCTGGTGCTCAGG + Intergenic
1160781700 19:880325-880347 CTCCTGCTCCCCTGGTGCTCAGG - Intronic
1162418775 19:10553933-10553955 CTGCCTGCTCCCTGGTGCTCAGG + Exonic
1163759873 19:19130383-19130405 GTGCTTGTTCCCTGGAGTTCTGG - Intronic
1164578835 19:29421910-29421932 CTGCTGGTCCCTAGGTGCTCTGG - Intergenic
1165245182 19:34494523-34494545 GTGCTTGTGCCCTTGGCCTCTGG + Intronic
1166291463 19:41866343-41866365 CTGGTTGTGCCCTGGGGCTCTGG - Intronic
1166818360 19:45560772-45560794 GTGCCTGTGGCCTGGAGCTCCGG - Intronic
925834555 2:7931445-7931467 CTGCTTGTCCCCTGCAGCTGGGG - Intergenic
935360901 2:102245578-102245600 GTGGTTTTCCCTTGGTACTCGGG + Intergenic
937229663 2:120390310-120390332 AGGCTTATGCCCTGGTGCTCTGG + Intergenic
937851025 2:126636465-126636487 GTACATGTACCCTGGTGTTCAGG - Intergenic
940855809 2:158727891-158727913 GTGCCTGTCACCCAGTGCTCTGG + Intergenic
948480828 2:238249466-238249488 AACCTTGTCCCCTGGGGCTCAGG + Intronic
948610790 2:239165373-239165395 GCGCGTGTCCAGTGGTGCTCAGG - Intronic
948698689 2:239747348-239747370 GTGCCTGTCCCCTGCTGCTCTGG + Intergenic
948704492 2:239780398-239780420 GTGCTTGTCCAGTGGCGGTCAGG - Exonic
1169786577 20:9365948-9365970 TTGCTGCTCCTCTGGTGCTCAGG + Intronic
1170609647 20:17902171-17902193 GTGCTTGGCCCCAGGTACTCTGG - Intergenic
1175543629 20:59763795-59763817 CTGGTTCTCCCCTGGAGCTCTGG - Intronic
1176093599 20:63329617-63329639 GTGCTAGCCCCCTGCTGCCCAGG - Exonic
1176111593 20:63413411-63413433 GTTCTTGTCCCCTGCTGGACAGG + Intronic
1176449033 21:6846541-6846563 CTGTTTTTCTCCTGGTGCTCTGG + Intergenic
1176827202 21:13711564-13711586 CTGTTTTTCTCCTGGTGCTCTGG + Intergenic
1180243734 21:46531242-46531264 GTGAGTGTCCCCTGCTGCTGAGG - Intronic
1180835079 22:18925764-18925786 GTGCCTGTCACCTGAGGCTCAGG - Intronic
1184735999 22:46398169-46398191 GTGCCTGTCCCCTGGAGCCAGGG - Intronic
1184991484 22:48173163-48173185 GAGCTTGGCACCTGGGGCTCTGG - Intergenic
1203285168 22_KI270734v1_random:151063-151085 GTGCCTGTCACCTGAGGCTCAGG - Intergenic
950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG + Intronic
952899381 3:38099567-38099589 GTGCATCTCCCTTGGAGCTCTGG - Intronic
954177834 3:48858465-48858487 GTGCTTTCCCTCTGGGGCTCAGG - Intronic
954370583 3:50167828-50167850 GTGCCTGTCCCCTTGGCCTCTGG + Intronic
956384698 3:68704101-68704123 TTTCCTGTCCCTTGGTGCTCAGG - Intergenic
962007469 3:131362407-131362429 GTCCTTGGCCCCTGTTGCGCTGG - Intergenic
963880270 3:150520610-150520632 CTGCTGGTCCCCTGGAGCTGGGG - Intergenic
965360558 3:167734523-167734545 GAGGTTGGCCCCTGGTGCCCCGG - Intronic
966878853 3:184338530-184338552 GTGCTGGGCCCCTGGTGGTGGGG + Intronic
968491917 4:894448-894470 GCCCTTGTCCCCTTGGGCTCGGG - Intronic
969292908 4:6252171-6252193 GTGCTTGTTGCCTGGGTCTCTGG + Intergenic
969490874 4:7498613-7498635 GTGCTGATCCCCTGCTGCCCAGG - Intronic
973566545 4:52194484-52194506 GTGGCTGTCCCCTGGTTCTCTGG - Intergenic
984940128 4:184923847-184923869 GATCTTGTCCCCTGGTGTTTGGG - Intergenic
986457935 5:7939161-7939183 GGGCATGTCCTCTGGAGCTCTGG + Intergenic
992231766 5:74670884-74670906 GTGCTTGGCCCCTGGTGGGAGGG - Intronic
996614558 5:125425163-125425185 GTGCTCTTCCCAAGGTGCTCAGG - Intergenic
997977383 5:138448372-138448394 CTTCTTGGCCCCTGGAGCTCTGG - Intergenic
999011161 5:148042290-148042312 GTGTTTGTCCCCTGGAATTCAGG + Intronic
1001425331 5:171618787-171618809 GTGCTTGTCAGGTGGTGCCCTGG - Intergenic
1002187797 5:177462636-177462658 GTCGGTGTCCCCTGCTGCTCAGG + Intronic
1002261178 5:177995064-177995086 GTGCTTGTCCCCTGCTGGCGAGG + Intronic
1007073056 6:39050149-39050171 GAGGTTGTCTCCTGGGGCTCAGG - Intronic
1008535192 6:52502117-52502139 ATGCTGGTCCCTTGGTGTTCAGG - Exonic
1016282869 6:142439064-142439086 TTGCTTGTGCCCTGGAGTTCAGG + Intronic
1016835311 6:148470881-148470903 GAGTTGGTCCCCTGGTTCTCTGG - Intronic
1018173927 6:161163059-161163081 GTGCCTGTCCCCAGAGGCTCTGG - Intronic
1019378087 7:706784-706806 GGGCTGGGCCTCTGGTGCTCTGG - Intronic
1021024211 7:15643836-15643858 GTGCTTGTGTCCTGGGGCACTGG + Intronic
1021131292 7:16915808-16915830 GGGCTGGTCCCCCGGGGCTCAGG + Intergenic
1024238446 7:47415384-47415406 GTGCTTGGTGCCTGGTGCGCTGG - Intronic
1034873849 7:154707289-154707311 GTGCTTGCCTCATGGTGCTGTGG - Intronic
1037694703 8:21213460-21213482 GTGCTTCACACCTGGTGCTGGGG - Intergenic
1037803078 8:22045463-22045485 GGCCTTGCCCCCTGGTGCTCAGG - Intronic
1046229654 8:111336231-111336253 GTGCTTTTCTCCTGGAGTTCCGG + Intergenic
1049099243 8:140567513-140567535 CTGCTTGTCCCCTTGTGTGCAGG - Intronic
1052474900 9:28946505-28946527 ATTCCTTTCCCCTGGTGCTCTGG + Intergenic
1053204192 9:36172597-36172619 GTGCTTGCCCTCTGCTGCCCTGG + Intergenic
1055680622 9:78711452-78711474 GTGCCTTTCCGCTTGTGCTCTGG - Intergenic
1056135754 9:83628240-83628262 GTGCTTGTCCCATTGTGTTCTGG + Intronic
1056999373 9:91493284-91493306 GAGCTTGTCCCCTGTGGCTCTGG - Intergenic
1058823665 9:108755545-108755567 GTGGTCCTCCCATGGTGCTCTGG - Intergenic
1059798923 9:117730043-117730065 GAGCCTGTCCCCTTGTCCTCTGG - Intergenic
1060891627 9:127192899-127192921 GCCCTTGGCACCTGGTGCTCGGG - Intronic
1061003419 9:127915423-127915445 GTGGCTGTCCCCTGGTGATCCGG + Intronic
1061857131 9:133448555-133448577 GAGCCTGTCCCTTGGGGCTCTGG + Intronic
1203520156 Un_GL000213v1:37976-37998 CTGTTTTTCTCCTGGTGCTCTGG - Intergenic
1186191262 X:7069426-7069448 GTGCCCGGCCCCTGGTTCTCAGG - Intronic
1192556614 X:72095074-72095096 GTGCTTGGCCCCTGTTGCCATGG + Intergenic