ID: 950509154

View in Genome Browser
Species Human (GRCh38)
Location 3:13415358-13415380
Sequence GCTCCCGCAGGGCCTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 447}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950509154_950509164 27 Left 950509154 3:13415358-13415380 CCTCTCCCAGGCCCTGCGGGAGC 0: 1
1: 0
2: 3
3: 41
4: 447
Right 950509164 3:13415408-13415430 TGCCAGAAATGCCATCAAATAGG 0: 1
1: 0
2: 0
3: 21
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950509154 Original CRISPR GCTCCCGCAGGGCCTGGGAG AGG (reversed) Intronic